Peli1 (NM_023324) Mouse Untagged Clone

CAT#: MC201212

Peli1 (untagged) - Mouse pellino 1 (Peli1), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Peli1 (NM_023324) Mouse Untagged Clone
Symbol Peli1
Synonyms 2810468L03Rik; A930031K15Rik; AA409794; AI586297; D11Ertd676e
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC016515 sequence for NM_023324
ATTTGAGAAAGACAGCCAAGCTCATGTTTTCTCCTGATCAAGAAAATCATCCTTCCAAAGCCCCAGTAAA ATATGGCGAACTCATTGTCTTAGGATATAATGGATCTCTCCCAAACGGTGATAGAGGAAGGAGGAAAAGT AGGTTTGCTTTGTTTAAAAGACCTAAGGCAAATGGGGTGAAGCCTAGCACCGTGCACATTGCATGTACTC CTCAGGCTGCCAAGGCAATAAGCAACAAGGACCAGCATAGCATATCATATACTTTATCTCGAGCCCAGAC GGTGGTGGTTGAATATACTCATGACAGCAACACTGATATGTTTCAGATTGGTCGGTCAACTGAAAGTCCT ATTGATTTTGTAGTAACTGACACCGTTCCTGGAAGTCAGAGTAATTCCGACACGCAGTCAGTACAAAGCA CTATATCAAGATTTGCCTGTAGGATCATATGTGAGCGCAGTCCCCCCTTTACAGCTCGGATTTATGCTGC AGGGTTTGATTCATCAAAAAACATCTTTCTTGGGGAGAAGGCTGCCAAGTGGAAGACATCTGATGGGCAG ATGGATGGCTTGACCACTAATGGAGTTCTTGTGATGCATCCACGTAATGGGTTCACAGAAGACTCCAAAC CTGGAATATGGAGAGAAATATCAGTATGTGGGAACGTCTTCAGTCTGCGTGAAACCAGATCAGCTCAGCA GAGAGGAAAGATGGTGGAAATTGAAACCAATCAGCTACAAGATGGCTCCTTAATTGACCTTTGTGGTGCA ACCTTGCTGTGGCGTACTGCAGAAGGCCTTTCCCATACTCCTACTGTGAAGCACTTAGAAGCTTTAAGAC AGGAGATCAATGCAGCTCGGCCGCAGTGCCCTGTAGGGTTCAACACACTAGCCTTCCCCAGTATGAAGAG GAAGGATGTTGTAGATGAAAAGCAACCATGGGTATATCTAAACTGCGGCCATGTCCATGGTTATCATAAC TGGGGAAACAAAGAAGAACGTGACGGCAAAGATCGTGAATGTCCTATGTGTAGGTCTGTTGGTCCCTATG TCCCTCTGTGGCTTGGATGTGAAGCTGGATTTTATGTGGACGCCGGCCCTCCCACCCATGCCTTTAGCCC CTGTGGGCACGTGTGTTCAGAAAAGACAACGGCTTACTGGTCCCAGATCCCACTTCCTCATGGTACGCAC ACTTTTCATGCAGCCTGCCCCTTCTGTGCACATCAGTTGGCTGGTGAACAAGGCTATATCAGACTTATTT TCCAAGGACCTTTAGACTAGCAGCTGTCCTCCAGGACTGCATTGTAAGTTTATAAGCTAAGTGATTGGGT TTGCTAACCGACCCCTTGTCCATGTAAGTTTCTCTGCTCTGGTCATTTGCATTAAGATGAAGAATTTTTT AAATATTTATAAGCAATTTCTGAGAAAAATCTGGGAAACTCAAGCAAAGGAATTTTTGAAAGTTCCAGAC TTCTGAACTCTGAGTTTTGAAAATCTATTTTGAGAAAAAAAAGACATAGTTTAATTTGATGCCTTCCTTT GTTTAGTGTTCTTGAATCACCGCCCACCCTCAGTGTTGAGAGGTTGTGCTGTAGAACTGAGGGTCTGTTG GTTCAAACTATGTTAGTTTACAATTTGTTGCAGACATTGTAAAATACAGCAACATGTATATTAATTTTTC TATTTATCTTTATCATAGAAAGTACCTTAGAATGTTGTGATAGGCTAGCATGGTAATGATGGTGTCACAC ATTTGGTGTGAGTGGTAGGGTAGTGAGCACAAGGCTCAAAGGTTTGCAAAGTTAAGGAGAAAGACAGGAG AGCTTCCCCCCCCCCCAGCCCCATAATTAGGGGATATTTCATAAAACCAGAATATTTCATAAAACCAGAT TCATATTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_023324
ORF Size 1257 bp
Insert Size 1257
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC016515, NP_075813
RefSeq Size 1912
RefSeq ORF 1257
Locus ID 67245
Cytogenetics 11 A3.1|11 13.81 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.