Tcim (NM_026931) Mouse Untagged Clone

CAT#: MC201192

1810011O10Rik (untagged) - Mouse RIKEN cDNA 1810011O10 gene (1810011O10Rik), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tcim
• Synonyms: 1110065B09Rik; AW121743; AW321058
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC016562 sequence for NM_026931
  CACATCGATGAAAGCCAAGCCAAGCCATCAAGCCACCAGCATGTCCTCGTCTCTTCGAGTAAGCCCGTCC ATCCACGGCTACCACTTCGACACAGCCGCTCGCAAGAAAGCTGTGGGCAACATCTTTGAGAACATAGACC AGGAGTCCCTGCAGAGGCTCTTCAGGAACTCCGGAGACAAGAAGGCAGAGGAGCGGGCCAAGATCATTTT TGCCATCGACCAAGATTTGGAGGAGAAAACTCGAGCCCTCATGGCCCTGAAGAAGAGGACAAAAGACAAG CTTCTTCAGTTTCTCAAACTGCGGAAATATTCCATCAAGGTACACTGAGCACAGCAGGCTGGGCAAGAGC GTATCCACCAATGGACCTTTAAAGACCCAGTGAGCCTGCCAGCTCTGGCACGGGCAGTGTCCCGCGAAAA GGCTTGAGAGCTTCCTCCGACAGGACCCCGAGGATGGAAAGGGACATACATAACTCACCAGCTACACAGA CTTGCAACTCATTGCAGCCCTGAGCTGTCCCACTGGGAGCCAAGTGCCTTCAGCAGGCGTTGAGAACTCT CACAGCAGGAAAGGACATAGCCTGAGAGGATGGAGGCACTGACCAGAACACTGCGTTTGTGGGGACTGAG TGCACGCACCCAGGGCCGTTGGCAAGGCCCTAAGACTAAACTCAAACCTAACTTGGTTTTTGTTCTTGTT GTTCGGTTTATTATTTTGTTTTCTTTTTTCTTTTCTTCCTTTTTTCTTTTTTTAAATATTGAAGTGGGGA GGGAGGGAAGAGAAGGAATATGAAGCATAAGTGGTTTACTGAAGTTTTGTGTGTTTTTTTTTTAAATCTG AATGTTTAAAAATGTGGCTAAATCTCCGTGCTGTTTATTGGTCAAGATTTTTAGAGATCAGTAATTGTCT GCTTGCATTGAATACAATGGCTAAGACAGTGCACCCCCTGCTGTTAAAGTCAAAGAACTGGATGCCTGGC CCAGCCCAGTAAAACCCCACAGCATGGGCTATGTTTCTACAGGATTTGTACACACTTCAAAATGGTTTGC ACAAAGCTGAAATAATGGGGCCCTTCATAAATCCGAAGGACTGTGAACAACTTTCGAATGTGCTTTTTAA AACTCTCTGACTAATGCTAAAATCTAATCTAATTAAATGTCCTCCAGACACTGTAGTAAGCATTAGGAAA TGAATATGGGGGATTTTAGAAGGATGCTGTGGGTTTTTTAAAATTATTTATTATGCATTGTAAGTGATAC ATAGCCCTAATAAATTATTATCAACTTAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_026931
• Insert Size: 321 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC016562, AAH16562
• RefSeq Size: 1302 bp
• RefSeq ORF: 321 bp
• Locus ID: 69068
• UniProt ID: Q9D915
• Cytogenetics: 8 A2
• Gene Summary: Seems to be involved in the regulation of cell growth an differentiation, may play different and opposite roles depending on the tissue or cell type. May enhance the WNT-CTNNB1 pathway by relieving antagonistic activity of CBY1. Enhances the proliferation of follicular dendritic cells. Plays a role in the mitogen-activated MAPK2/3 signaling pathway, positively regulates G1-to-S-phase transition of the cell cycle. In endothelial cells, enhances key inflammatory mediators and inflammatory response through the modulation of NF-kappaB transcriptional regulatory activity. Involved in the regulation of heat shock response, seems to play a positive feedback with HSF1 to modulate heat-shock downstream gene expression (By similarity). Plays a role in the regulation of hematopoiesis even if the mechanisms are unknown (PubMed:24937306). In cancers such as thyroid or lung cancer, it has been described as promoter of cell proliferation, G1-to-S-phase transition and inhibitor of apoptosis. However, it negatively regulates self-renewal of liver cancer cells via suppresion of NOTCH2 signaling (By similarity).[UniProtKB/Swiss-Prot Function]