Fam162a (NM_027342) Mouse Untagged Clone

SKU
MC201170
Fam162a (untagged) - Mouse family with sequence similarity 162, member A (Fam162a), (10ug)
  $150.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Fam162a
Synonyms 2310056P07Rik; HGTD-P
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC010826 sequence for NM_027342
GCGTCGGCGGAGCGGGTGGCCATGTGGAGCCTCGGCGGCCTGCGCCTGGCGGCTGGACATTGTCTTAGGT TATATGAAAGAAATGCTTCCTCGTCTCTAAGGTTTACCAGAAACACTGACTTGAAGAGGATCAATGGATT CTGCACCAAGCCACAGGAAAGTCCCAAAACTCCAACCCAGTCTTACAGACACGGGGTGCCGCTGCACAAG CCCACAGATTTTGAGAAGAAGATCCTGCTGTGGTCAGGCCGCTTCAAGAAGGAGGAAGAGATCCCAGAGA CAATCTCATTTGAGATGCTTGATGCTGCGAAGAACAAGCTCCGGGTGAAGGTCAGCTATCTAATGATTGC CCTGACCGTGGCAGGATGCATCTATATGGTTATTGAGGGCAAGAAGGCTGCGAAAAGACATGAGTCTTTA ACAAGCTTGAACCTGGAAAGGAAAGCCCGTCTGAGAGAGGAGGCAGCTATGAAGGCCAAAACAGACTAGA AGTATTTGGAAAACCCAGGAGTAAGGCTGCAACAAGAAACCTGCTTTACAAAGGATACAATCTGAGACTC ACTTTGCAGACATGTATTTTGCACAGATGTATTCCACTTCCCTATTAATGCTGTAGAGGAACAAATACAT TTTCTTAAAGAATGAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_027342
Insert Size 468 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC010826, AAH10826
RefSeq Size 670 bp
RefSeq ORF 468 bp
Locus ID 70186
UniProt ID Q9D6U8
Cytogenetics 16 B3
Summary Proposed to be involved in regulation of apoptosis; the exact mechanism may differ between cell types/tissues. May be involved in hypoxia-induced cell death of transformed cells implicating cytochrome C release and caspase activation (such as CASP9) and inducing mitochondrial permeability transition. May be involved in hypoxia-induced cell death of neuronal cells probably by promoting release of AIFM1 from mitochondria to cytoplasm and its translocation to the nucleus; however, the involvement of caspases has been reported conflictingly.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_027342" in other vectors (4)
SKU Description Size Price
MG201149 Fam162a (tGFP-tagged) - Mouse RIKEN cDNA 2310056P07 gene (2310056P07Rik) 10 ug
$350.00
MR201149 Fam162a (Myc-DDK-tagged) - Mouse family with sequence similarity 162, member A (Fam162a) 10 ug
$289.00
MR201149L3 Lenti ORF clone of Fam162a (Myc-DDK-tagged) - Mouse family with sequence similarity 162, member A (Fam162a) 10 ug
$450.00
MR201149L4 Lenti ORF clone of Fam162a (mGFP-tagged) - Mouse family with sequence similarity 162, member A (Fam162a) 10 ug
$450.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products