Sprr2a1 (NM_011468) Mouse Untagged Clone

CAT#: MC201169

Sprr2a1 (untagged) - Mouse small proline-rich protein 2A1 (Sprr2a1), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Sprr2a1 (NM_011468) Mouse Untagged Clone
Symbol Sprr2a1
Synonyms Sprr2a; Sprr2a3
Vector pCMV6-Kan/Neo
Sequence Data
>BC010818 sequence for NM_011468
CAAGCATTGGTCTGCTCCGGAGAACCTGATTCTGAGACTCAAGTACGATGTCTTACTACCAGCAGCAGTG CAATCAGCCGTGCCGGCCTCCTCCTGTGTGCCCACCCCCGAAGTGCCCTGAGCCTTGTCCTCCCCAAGTG TGGCCTGGGCCTTGTCGTCCTGTCATGTGCTTTGAGCCTTGTCTTCCTTCAGTGTGGCCTGGGCCGTGTC GTCCTGTAGTGTGCTATGAGCAATGCCCACCTCAGCCATGGCAGTCAACATGCCCTCCTGTGCAATTTCC ACCATGCCAGCAGAAGTGACCACCCAACAGGTGAAGGCCTCCCAGTCATCAGGACCAGGGGAAGTGAAAG AAATCTGTCTCACCAGCTCACCGACTCCATAGCAACACTTCCATCCTCCTTTGAAAGCCTGTCTGGATGC AGAAGAATCTTCTCCACCCTTCATCCTCCATGTGCTTATGATGGCTCCTCACAGAGAAGGCATTGCTCTC AGGCTGATCTCCTGCTGCTTTCCTGGGGATGCTGAGAATGATCCTTTCTCTTGTTTTTGTACACCAGGGG AAGCACAACAGGTATCTACTCTGTGCTTTCAGAGGAGCCTTCTCAGCCTGCCTGTTACCTGATCAGGGCA ATGGTCACTGCTGTTTCATTTCCTGAAATAAAAAAGGACCCCTTTGGTGATGGTCTAATAAATACTTTTT TTCTTGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_011468
ORF Size 252 bp
Insert Size 252
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC010818, NP_035598
RefSeq Size 738
RefSeq ORF 252
Locus ID 20755
Cytogenetics 3 F1|3 40.14 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.