Igh (BC018322) Mouse Untagged Clone

SKU
MC201124
Igh (untagged) - Mouse immunoglobulin heavy chain complex (cDNA clone MGC:19109 IMAGE:4208089), (10ug)
  $457.00
In Stock*
Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Igh
Synonyms AI893585
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC018322
GAACACACTGACTCAAACCATGGAATGGTGCTGGGTCTTTCTCTTCCTCCTGTCAGTAACTGCAGGTGTC CACTCCAAGGTCCAACTGCAGCAGTCTGGAGCTGAACTGGTGAAACCCGGGGCATCAGTGAAGCTGTCCT GCAAGGCTTCTGGCTACACCTTCAGTGACTATTTTATACACTGGATAAAACAGAGGTCTGGACAGGGTCT TGAGTGGATTGGGTGGTTTAACCCTGGAAGTGGTAGTATAAAGTTCAATGAGAAATTCAAGGACAAGGCC ACATTGACTGCGGACAAATCCTCCACTACAGTCTATATGGACCTTAGTAGATTGACATCTGAAGACTCTG CGGTCTATTTCTGTGCAAGACACGAAGATAGAGGGAATTACGATGGTAGCCTGGCCTGGTTTGTTTATTG GGGCCAAGGGACTCTGGTCACTGTCTCTGCAGAGCCTGCAAGAGAGCCCACCATCTACCCACTGACATTC CCACAAGCTCTGTCAAGTGACCCAGTGATAATCGGCTGCCTGATTCATGATTACTTCCCTTCCGGCACGA TGAATGTGACCTGGGGAAAGAGTGGGAAGGATATAACCACCGTAAACTTCCCACCTGCCCTGGCCTCTGG GGGACGGTACACCATGAGCAGCCAGTTGACCCTGCCAGCTGTCGAGTGCCCAGAAGGAGAATCCGTGAAA TGTTCCGTGCAACATGACTCTAACCCCGTCCAAGAATTGAACGTGAATTGCCCTGGTATCTGTTCTCCTC CTACTACTCCTCCTCCACCTTCCTGCCAGCCCAGCCTGTCACTGCAGCGGCCAGCTCTTGAGGACCTGCT CCTGGGTTCAGATGCCAGCATCACATGTACTCTGAATGGCCTGAGAGATCCTGAGGGAGCTGTCTTCACC TGGGAGCCCTCCACTGGGAAGGATGCAGTGCAGAAGAAAGCTGTGCAGAATTCCTGCGGCTGCTACAGTG TGTCCAGCGTCCTGCCTGGCTGTGCTGAGCGCTGGAACAGTGGCGCATCATTCAAGTGCACAGTTACCCA TCCTGAGTCTGACACCTTAACTGGCACAATTGCCAAAGTCACAGTGAACACCTTCCCACCCCAGGTCCAC CTGCTACCGCCGCCGTCGGAGGAGCTGGCCCTGAATGAGCTCGTGTCCCTGACATGCCTGGTGCGAGCTT TCAACCCTAAAGAAGTGCTGGTGCGATGGCTGCATGGAAATGAGGAGCTGTCCCCAGAAAGCTACCTAGT GTTTGAGCCCCTAAAGGAGCCAGGCGAGGGAGCCACCACCTACCTGGTGACAAGCGTGTTGCGTGTATCA GCTGAAATCTGGAAACAGGGTGACCAGTACTCCTGCATGGTGGGCCACGAGGCCTTGCCCATGAACTTCA CCCAGAAGACCATCGACCGTCTGTCGGGTAAACCCACCAATGTCAGCGTGTCTGTGATCATGTCAGAGGG AGATGGCATCTGCTACTGAGCCACCCTGCCTGTCCCTACTCCTGAAATAAACTCTGTGCTCATCCAAAAA AAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN BC018322
Insert Size 1470 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC018322, AAH18322
RefSeq Size 1550 bp
RefSeq ORF 1470 bp
Locus ID 111507
Cytogenetics 12 F1-F2|12
Summary Summary:Immunoglobulins recognize foreign antigens and initiate immune responses such as phagocytosis and the complement system. Each immunoglobulin molecule consists of two identical heavy chains and two identical light chains. This region represents the germline organization of the heavy chain locus. The locus includes V (variable), D (diversity), J (joining), and C (constant) segments. During B cell development, a recombination event at the DNA level joins a single D segment with a J segment; this partially rearranged D-J gene is then joined to a V segment. The rearranged V-D-J is then transcribed with the IGHM constant region; this transcript encodes a mu heavy chain. Later in development B cells generate V-D-J-Cmu-Cdelta pre-messenger RNA, which is alternatively spliced to encode either a mu or a delta heavy chain. Mature B cells in the lymph nodes undergo switch recombination, so that the V-D-J gene is brought in proximity to one of the IGHG, IGHA, or IGHE genes and each cell expresses either the gamma, alpha, or epsilon heavy chain. Recombination of many different V segments with several J segments provides a wide range of antigen recognition. Additional diversity is attained by junctional diversity, resulting from the random additional of nucleotides by terminal deoxynucleotidyltransferase, and by somatic hypermutation, which occurs during B cell maturation in the spleen and lymph nodes. The RefSeq represents the IGH locus from C57BL/6. Several V and D segments in C57BL/6 are known to be incapable of encoding a protein and are considered pseudogenes. provided by RefSeq, Jul 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products