Gstt1 (NM_008185) Mouse Untagged Clone

CAT#: MC201057

Gstt1 (untagged) - Mouse glutathione S-transferase, theta 1 (Gstt1), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gstt1 (NM_008185) Mouse Untagged Clone
Symbol Gstt1
Synonyms AI255817; Gstt1-1
Vector pCMV6-Kan/Neo
Sequence Data
>BC012254 sequence for NM_008185
GCCATGGTTCTGGAGCTGTACCTGGATCTGCTGTCGCAGCCCTGTCGCGCCATTTATATCTTCGCCAAGA AGAACAATATCCCGTTCCAGATGCACACGGTGGAGCTGCGCAAGGGTGAGCACCTCAGCGATGCGTTTGC CCGGGTGAACCCCATGAAGAGGGTACCAGCCATGATGGATGGTGGCTTCACCCTGTGTGAGAGTGTGGCT ATCTTGCTCTACCTGGCACACAAGTATAAGGTTCCTGACCACTGGTACCCCCAAGACCTGCAGGCTCGTG CTCGTGTAGACGAGTACCTGGCATGGCAGCATACGGGCCTTCGGAGAAGCTGCCTCAGGGCCCTGTGGCA TAAGGTGATGTTCCCTGTTTTCCTTGGTGAGCAAATACCTCCTGAAACACTGGCAGCCACGTTGGCAGAA CTGGATGTTAACCTACAGGTGCTTGAAGACAAGTTCCTCCAGGACAAAGACTTCCTTGTTGGGCCCCACA TCTCCCTGGCCGACTTGGTGGCCATCACAGAGCTGATGCATCCTGTAGGTGGTGGCTGCCCAGTCTTTGA AGGGCATCCCAGGCTGGCTGCATGGTACCAGCGAGTGGAGGCAGCTGTGGGGAAGGACCTCTTCCGGGAA GCCCATGAAGTCATCCTGAAGGTGAAGGACTGTCCCCCTGCTGACCTCATCATAAAGCAGAAGCTGATGC CCAGAGTGCTGGCAATGATCCAGTGACGTCAGACGCTTCATCCCTGCACCAGCTGCGGCAGTTCACAACT CACAGTTCACAATTCACAACTTGCATTACACTGGGGATGCACCTCACTCCTCACACCATGATGGCTCTCA GGCTCAGCTCCATCTTCACCCTTTTTCTGTGATAGCCACACATGACCTCAACTATAATCACTACTTTCCC CTTGAGTCTGGGTAATAAACTGGGGCTTGATTTGGGCTTTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_008185
ORF Size 723 bp
Insert Size 723
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC012254, NP_032211
RefSeq Size 965
RefSeq ORF 723
Locus ID 14871
Cytogenetics 10 C1|10 38.58 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.