OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Klk1b5 (NM_008456) Mouse Untagged Clone

Be the first to review this product
SKU
MC201053
Klk1b5 (untagged) - Mouse kallikrein 1-related peptidase b5 (Klk1b5), (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP DDK
AAV Particle:
DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (3)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Klk1b5 or NM_008456"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Klk1b5
Synonyms kallikrein; Klk; Klk5; mGK-5
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC013659 sequence for NM_008456
GCTCCTGGACAGCTGTCACCATGTGGTTCCTGATCCTGTTCCTAGCCCTGTCCCTAGGAGGGATTGATGC TGCACCTCCTGTCCAGTCTCGAATTTTTGGAGGATTTAACTGTGAGAAGAACTCCCAACCCTGGCAAGTG GCTGTGTACCGCTTCACCAAATATCAATGCGGGGGAGTCCTGCTGAACGCCAACTGGGTTCTCACTGCTG CCCACTGCCATAATGACAAGTACCAGGTTTGGCTGGGCAAAAACAACTTTTTTGAGGATGAACCCTCTGC CCAACACCGGCTTGTCAGCAAAGCCATCCCTCACCCTGACTTCAACATGAGCCTCCTGAATGAGCACACC CCACAACCTGAGGACGACTACAGCAATGACCTGATGCTGCTCCGCCTCAAAAAGCCTGCTGACATCACAG ATGTTGTGAAGCCCATCGACCTGCCCACTGAGGAGCCCAAGCTGGGGAGCACATGCCTAGCCTCAGGCTG GGGCAGCATTACACCCGTCATATACGAACCCGCAGATGATCTCCAGTGTGTGAACTTCAAGCTCCTGCCT AATGAGGACTGTGTCAAAGCCCACATAGAGAAGGTGACAGATGTTATGTTGTGTGCAGGAGATATGGATG GAGGCAAAGACACTTGTATGGGTGACTCAGGAGGCCCACTGATCTGTGATGGTGTTCTCCACGGTATCAC ATCATGGGGCCCTAGCCCTTGCGGTAAACCCAATGTGCCAGGTATCTACACCAAACTTATTAAGTTTAAC TCTTGGATAAAAGACACTATAGCTAAAAATGCCTGAATATCACATTGTCCCATGTTCTCAATAAAGCCCA CCATGCAGCAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_008456
Insert Size 786 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC013659, AAH13659
RefSeq Size 876 bp
RefSeq ORF 786 bp
Locus ID 16622
UniProt ID P15945
Cytogenetics 7 28.73 cM
Summary This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. provided by RefSeq, Feb 2016
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_008456" in other vectors (4)
SKU Description Size Price
MG203435 Klk1b5 (tGFP-tagged) - Mouse kallikrein 1-related peptidase b5 (Klk1b5) 10 ug
$500.00
MR203435 Klk1b5 (Myc-DDK-tagged) - Mouse kallikrein 1-related peptidase b5 (Klk1b5) 10 ug
$289.00 $300.00
MR203435L3 Lenti ORF clone of Klk1b5 (Myc-DDK-tagged) - Mouse kallikrein 1-related peptidase b5 (Klk1b5) 10 ug
$600.00
MR203435L4 Lenti ORF clone of Klk1b5 (mGFP-tagged) - Mouse kallikrein 1-related peptidase b5 (Klk1b5) 10 ug
$600.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products