Il1b (BC011437) Mouse Untagged Clone

CAT#: MC200970

Il1b (untagged) - Mouse interleukin 1 beta (cDNA clone MGC:18555 IMAGE:3989461), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Il1b (BC011437) Mouse Untagged Clone
Symbol Il1b
Synonyms IL-1beta
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC011437
CGAGGCCTAATAGGCTCATCTGGGATCCTCTCCAGCCAAGCTTCCTTGTGCAAGTGTCTGAAGCAGCTAT GGCAACTGTTCCTGAACTCAACTGTGAAATGCCACCTTTTGACAGTGATGAGAATGACCTGTTCTTTGAA GTTGACGGACCCCAAAAGATGAAGGGCTGCTTCCAAACCTTTGACCTGGGCTGTCCAGATGAGAGCATCC AGCTTCAAATCTCACAGCAGCACATCAACAAGAGCTTCAGGCAGGCAGTATCACTCATTGTGGCTGTGGA GAAGCTGTGGCAGCTACCTGTGTCTTTCCCGTGGACCTTCCAGGATGAGGACATGAGCACCTTCTTTTCC TTCATCTTTGAAGAAGAGCCCATCCTCTGTGACTCATGGGATGATGATGATAACCTGCTGGTGTGTGACG TTCCCATTAGACAGCTGCACTACAGGCTCCGAGATGAACAACAAAAAAGCCTCGTGCTGTCGGACCCATA TGAGCTGAAAGCTCTCCACCTCAATGGACAGAATATCAACCAACAAGTGATATTCTCCATGAGCTTTGTA CAAGGAGAACCAAGCAACGACAAAATACCTGTGGCCTTGGGCCTCAAAGGAAAGAATCTATACCTGTCCT GTGTAATGAAAGACGGCACACCCACCCTGCAGCTGGAGAGTGTGGATCCCAAGCAATACCCAAAGAAGAA GATGGAAAAGCGGTTTGTCTTCAACAAGATAGAAGTCAAGAGCAAAGTGGAGTTTGAGTCTGCAGAGTTC CCCAACTGGTACATCAGCACCTCACAAGCAGAGCACAAGCCTGTCTTCCTGGGAAACAACAGTGGTCAGG ACATAATTGACTTCACCATGGAATCTGTGTCTTCCTAAAGTATGGGCTGGACTGTTTCTAATGCCTTCCC CAGGGCATGTGAAGGAGCTCCCTTGTCATGAATGAGCAGACAGCTCAATCTCTAGGAGACTCCTTAGTCC TCGGCCAAGACAGGTCGCTCAGGGTCACAAGAAACCATGGCACATTCTGTTCAAAGAGAGCCTGTGTTTT CCTCCTTGCCTCTGATGGGCAACCACTTACCTATTTATTTATGTATTTATTGATTGGTTGATCTATTTAA GTTGATTCAAGGGGACATTAGGCAGCACTCTCTAGAACAGAACCTAGCTGTCAACGTGTGGGGGATGAAT TGGTCATAGCCTGCACTGAGGTCTTTCATTGAAGCTGAGAATAAATAGGTTCCTATAATATGGATGAGAA TTTTTATGAATGAAGCACCAGCACATTGCTTTGATGAGTATGAAATAAATTTCATTAAAACAAACAAAAA AAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC011437
ORF Size 810 bp
Insert Size 810
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC011437,
RefSeq Size 1345
Locus ID 16176
Cytogenetics 2 F1|2 62.97 cM
Gene Summary The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1. The encoded protein plays a role in thymocyte proliferation and is involved in the inflammatory response. [provided by RefSeq, Aug 2015].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.