(BC018558) Mouse Untagged Clone

CAT#: MC200963

(untagged) - Mouse mRNA similar to fatty acid binding protein 4, adipocyte (cDNA clone MGC:18548 IMAGE:3670866), (10ug)

USD 176


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name (BC018558) Mouse Untagged Clone
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC018558
GCAGCCTTTCTCACCTGGAAGACAGCTCCTCCTCGAAGGTTTACAAAATGTGTGATGCCTTTGTGGGAAC CTGGAAGCTTGTCTCCAGTGAAAACTTCGATGATTACATGAAAGAAGTGGGTGAGTGCTGTGGGGGTCGG GGTCCCCCGGGCTGGGGAGAGGGCTTGCAGCTGCCTTGCAGCCCGGGGGGACAGGATGGAGCTGTGGTGG GAGAAAATGCTGCTTCCCGCATGGAGGGTGTATGTAGAAGCCACAAGAAAAAGTCTGTCCTAGAAGTTTT CTCAAAGCTTCAAGCTCGTGATCCCTCCAGGTGAACCCGCAAGAAAGAGTCTACAGGACAATCTTTTACT CTCTGTAGAACGACAAGATGTGGCCTTCTTTGCCAAGCTTGCGATTCTGAGGTTCATTTGGCTACTTGCC TGTTTTCAACATCTCCTTTTACATGAAAAATTTGTAATAATTTAAAGAGAAAAATATTCCTTCCGTTTGT TTTTTTTTTTAAAGGATGGGGGCAACTTTTACTTAAAACTGAAGTCATGATATTGCCCCTCTTAGAAAAC AAATCATGTTGGAAAATATATTTTAGCAAATTCTTTTCTGTCTCAATGTCAAGGCCTAAGAATGTGTGAT TATTTTACAGTTGACAAAAGCTTGGCTTCCGGAGATACTTTCCTTCAAGGACTTAAAGGTTTCTTCGTTG GTTTAGAGTGATATGTGATGTCATAGATTTGTGAGTAATTCAGAAGGAAAGCAGGGCATGCAAAGCACAC ATAGAACTTGCCCTTCCCACGATATGGGCTCACAACGGTCTATGTCCTGTCAACACTGCCCACAGGCTGC TGTGTGGCCAAACAGCTTTGCCTATCCGTATAGAGGGGCCATCGCCCAGCCAGCGATGTACTTCATCAGG AAGCGTCTGCTTTGAAGCCCTCTCTCCTGACCTCCCCATATTACAGAGTATCTCCGTTAGGACAGACTCC CCTCAACCTGCAAACCTTCCCTCAGTTATACAGTGGGAACTTTTGGTTGTCTGTCAATATTGTTGTCTTG TTTGCAGACAAGAAGAATATCGGGAATTTCAGCATGACTTAGCCCATCGACTGTTTACTGTTCAGTGTGG TAGTTACTATGCACTGAGCCAGAAATACCAGGGCTTGAGACACTTTTAGCTCTTGACCACTTGAAACATT TCATACTGCTACCATTCCTATCTAAATTATAATGACACTACTTAAGTTGTGAGAGACCCATGATTAAAGG CAGTAGATATTTCCTGAGTGGAACTGGCAACCGTAATTAAGGCAGAGTAGGCAGGTATTGGCTTCTGCAG TCAGATAAAAATGAAGACACAAGTGAAGCTGTTATTTGTCCCCGGCACGGTCTCTCTGCAATCATTTCCC AGTGCTGTGTCCCTTTCCTGCGCTGATTGATTGTACAGAATGCTGTGCTGTGTGGCAGAGTGACAATTCA AGGCAGAGACACACCATTTCCTCACTGTGGTACTGTTTAGACAGAGAACTAAGTCGTACCCTCTGCATCA TTTATCCTGTGGTGTGGTTGTCTCTCAGTTCATCCTTAGTTCTAGCTTTGGGTCACCTTTTGTCAAAGAC ATAGCCTTTATTTAAGCATTTGTGTTGAAGGAGTCAGTGCACCCGAGACAGAAGGATTCTGTGTAACATG CCGACAGGGTGACTAAGGTTCTAAGTTGTTCACCCTCCACAGGGAAGCTAAACAAACAAAGTTCACAGCT TAAGGGACCGAGATGCAGAGTGTTAGTTTCCAAACTTTTCTATACACTGACATTCTGATTTCCTGAGTTC AGAAGATACTTACCCAGTCTGCTTTACGTTTCCTGATTGTTGAGAATGCGATCACCATTCTAAAAGGACA TGAAATGTGAAACAGCATGTTCACTCTACAGAAATTAATCAGACAATTCATTTCATGAGGGAGTAATATG GGAAAGAAGCCTAGAAAATTAAATTTGGCAACAAGTGTTGTGAAATGTGATTTTTGTTCACTCAAAAATA GATGACCTTTTAACACAATAACTCTAAGTGAGGCCTGGCCTTTGACTTAGATTTTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC018558
ORF Size 1434 bp
Insert Size 1434
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC018558,
RefSeq Size 2100
RefSeq ORF 1434
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.