Fabp1 (NM_017399) Mouse Untagged Clone
CAT#: MC200911
Fabp1 (untagged) - Mouse fatty acid binding protein 1, liver (Fabp1), (10ug)
"NM_017399" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Fabp1 |
Synonyms | Fabpl; L-FABP |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC009812 sequence for NM_017399
CCACGCGTCCGGCTGTGGAAAGGAAGCCTCGTTGCCACCATGAACTTCTCCGGCAAGTACCAATTGCAGA GCCAGGAGAACTTTGAGCCATTCATGAAGGCAATAGGTCTGCCCGAGGACCTCATCCAGAAAGGGAAGGA CATCAAGGGGGTGTCAGAAATCGTGCATGAAGGGAAGAAAATCAAACTCACCATCACCTATGGACCCAAA GTGGTCCGCAATGAGTTCACCCTGGGGGAGGAGTGCGAACTGGAGACCATGACTGGGGAAAAAGTCAAGG CAGTCGTCAAGCTGGAAGGTGACAATAAAATGGTGACAACTTTCAAAGGCATAAAGTCCGTGACTGAACT CAATGGAGACACAATCACCAATACCATGACATTGGGCGACATTGTCTACAAGAGAGTCAGCAAGAGAATT TAGACAAGGCTATATTTCATATTCTTTTACAGTGTAAAATTAATACAATAAAGTTACCTTTCTTTTGGAA AAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_017399 |
Insert Size | 384 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC009812, AAH09812 |
RefSeq Size | 503 bp |
RefSeq ORF | 384 bp |
Locus ID | 14080 |
UniProt ID | P12710 |
Cytogenetics | 6 32.14 cM |
Gene Summary | Plays a role in lipoprotein-mediated cholesterol uptake in hepatocytes. Binds cholesterol. Binds free fatty acids and their coenzyme A derivatives, bilirubin, and some other small molecules in the cytoplasm. May be involved in intracellular lipid transport.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200680 | Fabp1 (tGFP-tagged) - Mouse fatty acid binding protein 1, liver (Fabp1) |
USD 350.00 |
|
MR200680 | Fabp1 (Myc-DDK-tagged) - Mouse fatty acid binding protein 1, liver (Fabp1) |
USD 150.00 |
|
MR200680L3 | Lenti ORF clone of Fabp1 (Myc-DDK-tagged) - Mouse fatty acid binding protein 1, liver (Fabp1) |
USD 450.00 |
|
MR200680L4 | Lenti ORF clone of Fabp1 (mGFP-tagged) - Mouse fatty acid binding protein 1, liver (Fabp1) |
USD 450.00 |
{0} Product Review(s)
Be the first one to submit a review