Sult2b1 (NM_017465) Mouse Untagged Clone

CAT#: MC200904

Sult2b1 (untagged) - Mouse sulfotransferase family, cytosolic, 2B, member 1 (Sult2b1), (10ug)


  "NM_017465" in other vectors (6)

Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Sult2b1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Sult2b1
Synonyms AI326997; BB173635; ST2B1; SULT2B
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC009811 sequence for NM_017465
CCACGCGTCCGGCTTCCCGCTCCCTCCCCCGCCTGCCCTGCGCTGCCAGCAGGGACTGCTGCCGGGAGCC CATCGGAGACCGCAGGTGGTGAATTCCCGGGATATCGTCGACCCACGCGTCCGCTACCTCCTGCCCTGCC CGCCATGGACGGGCCGCAGCCCCGCGCCCTGTGGAGCTCGTCTGAGAAAAATGTTTCCGAAATGAGCTGG AATTTTGGAGGTGAATACTTCAGATACAAAGGTATCCCTTTTCCTGTCGGCATGTACTCACCGGAGAGCC TCAGTCTGGCTGAGAACACTAGCAACGTGCGGGACGACGACATCTTCATTGTCACCTACCCCAAATCAGG TACCAACTGGATGATTGAGATCGTCTGCTTAATCCTGAAAGATGGGGATCCCTCGTGGATCCGATCGGAG CCCATCTGGCAACGTGCGCCCTGGTGCGAGACCATCATAAGCGCCTTCAATGTCTTAGACCGGCCCAGCC CCCGCATTATGAGCTCTCACCTCCCTATTGAACTCTTCACGAAGGCATTCTTCAGCTCCAAGGCTAAGGT GATTTACGTGGGCCGGAACCCCCGCGATGTCGTGGTCTCCCTCTATTATTATTCTAAGATTGCTGGGCAA TTAAAGGACCCTGGTACACCCGACCAGTTCCTTCAAAATTTCCTCAAAGGAGAAGTGCAGTTTGGCTCCT GGTTTGACCACATCAAGGGCTGGATCCGGATGCAGAACCAAGAGAACTTCCTGTTTATCACCTATGAGGA GCTGCAGCAGGACCTGCGAGGCTCCGTGCAACGCATCTGTGAGTTCCTGGGCCGGCCACTGGGTGAAGAG GCCCTGAGCTCTGTGGTGGCCCACTCAGCCTTTGCTGCCATGAAGGCCAATACCATGTCCAACTACTCGC TGCTGCCGGCCAGCCTGCTGGACCACCGCCAGGGGGAGTTCCTGCGCAAAGGGATCAGTGGCGACTGGAA GAACCACTTCACTGTGGCCCAGAGTGAGGCTTTTGACAGTGTTTACCGAGAGCAAATGCACGGGGTGCAG AGGTTCCCCTGGGACACGTCTGAAGAGGATAGCAGCCCTGATGGCCAGCCTGACCCTGAGCCCAGCCCCA GCCCAGCTTCTGATGACCCCAACCCAGGATCCTCACAATAAACTTATCACTCCAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_017465
Insert Size 1017 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC009811, AAH09811
RefSeq Size 1206 bp
RefSeq ORF 1017 bp
Locus ID 54200
UniProt ID O35400
Cytogenetics 7 B3
Gene Summary Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs and xenobiotic compounds. Sulfonation increases the water solubility of most compounds, and therefore their renal excretion, but it can also result in bioactivation to form active metabolites. Sulfates hydroxysteroids such as dehydroepiandrosterone. Isoform 1 is required for production of cholesterol sulfate essential for normal skin development whereas isoform 2 produces pregnenolone sulfate, an essential neurosteroid during development of the central nervous system. Plays a role in epidermal cholesterol metabolism and in the regulation of epidermal proliferation and differentiation.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.