Insl5 (NM_011831) Mouse Untagged Clone

CAT#: MC200861

Insl5 (untagged) - Mouse insulin-like 5 (Insl5), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Insl5
• Synonyms: RIF2
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC010968 sequence for NM_011831
  CCACGCGTCCGCTCATTTGCTCTCCGGCAGGATGAAGGGCCCCACTCTTGCTCTGTTTCTCCTCTTAGTT CTGTTGGCTGTGGTGGAAGTAAGAAGCAGGCAGACTGTGAAGCTCTGTGGCCTGGACTACGTGAGAACAG TTATCTACATCTGTGCCAGCTCACGGTGGAGGAGACATCTGGAGGGGCATTTCCACTCTCAACAAGCTGA GACAAGAAACTACCTCCAGCTCCTAGACAGGCACGAGCCATCCAAGAAAACTCTGGAGCACAGCCTTCCC AAGACGGATCTCTCAGGACAGGAGCTTGTTCGAGATCCACAGGCACCCAAGGAAGGTCTTTGGGAACTGA AGAAGCACTCAGTGGTATCCAGACGAGATCTGCAAGCTCTGTGCTGCAGGGAAGGCTGCTCCATGAAGGA ACTCAGCACCCTCTGTTAGGATGCGCCCAACCCCTTGGCAGGCTTCAGCATGCATCTCAATGTTCTACCA TCGAGTTCCCTGTTCAGCTTCTATCACTACAACCACGGCTTTTGATCCTTTCCTTAAAGGTCTATTATGG CTTAAAGCCACTCTTCTCCCTGTGCTGAGGTCAATCTACTTTTCTTTCTAAATTCTAACTACTGCTTTGA AGTTTCGAGTGCTGTGCAAAATTGCAATAAAAAAAAATGCCTGAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_011831
• Insert Size: 408 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC010968, AAH10968
• RefSeq Size: 710 bp
• RefSeq ORF: 408 bp
• Locus ID: 23919
• UniProt ID: Q9WUG6
• Cytogenetics: 4 47.27 cM
• Gene Summary: May have a role in gut contractility or in thymic development and regulation. Activates RXFP4 with high potency and appears to be the endogenous ligand for this receptor (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) contains an alternate 5' terminal exon and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2, which has a shorter N-terminus, compared to isoform 1.