Agr2 (NM_011783) Mouse Untagged Clone
CAT#: MC200841
Agr2 (untagged) - Mouse anterior gradient 2 (Xenopus laevis) (Agr2), (10ug)
"NM_011783" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Agr2 |
Synonyms | Agr2h; Gob-4; HAG-2; mAG-2; XAG-2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC013334 sequence for NM_011783
CCACGCGTCCGCTTGGACGGCAACCCTTGCGGCTCACACAAAGCAGGAGGGTGGGAAGCCCAGATTTGCC ATGGAGAAATTTTCAGTGTCTGCAATCCTGCTTCTTGTGGCCATTTCTGGTACCTTGGCCAAAGACACCA CAGTCAAATCTGGAGCCAAAAAGGACCCAAAGGACTCTCGGCCCAAACTACCTCAGACACTCTCCAGAGG TTGGGGCGATCAGCTCATCTGGACTCAGACATACGAAGAAGCTTTATACAGATCCAAGACAAGCAACAGA CCCTTGATGGTCATTCATCACTTGGACGAATGCCCACACAGTCAAGCCTTAAAGAAAGTGTTTGCTGAAC ATAAAGAAATCCAGAAATTGGCAGAGCAGTTTGTTCTCCTCAACCTGGTCTATGAAACAACCGACAAGCA CCTTTCTCCTGATGGCCAGTACGTCCCCAGAATTGTGTTTGTAGACCCATCCCTGACGGTGAGGGCAGAC ATCACTGGACGATACTCAAACCGGCTCTACGCTTATGAACCTTCTGACACAGCTTTGTTGTACGACAACA TGAAGAAAGCTCTCAAGCTGCTAAAGACAGAATTGTAGAGCTAACTGCGCACCGGGTCAGGAGACCAGAA GGCAGAAGCACTGTGGACTTGCAGATTACAGTACAGTTTAATGTTACAACAGATATATTTTTTAAACACC CACAGGTGGGGAAACAATATTATTATCTACTACAGTGAAGCATGATTTTCTAGAAAATAAAGTCTTGTGA GAACTCCAGCTGAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011783 |
Insert Size | 528 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC013334, AAH13334 |
RefSeq Size | 802 bp |
RefSeq ORF | 528 bp |
Locus ID | 23795 |
UniProt ID | O88312 |
Cytogenetics | 12 A3 |
Gene Summary | Required for MUC2 post-transcriptional synthesis and secretion. May play a role in the production of mucus by intestinal cells. Proto-oncogene that may play a role in cell migration, cell differentiation and cell growth (By similarity). Promotes cell adhesion (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201533 | Agr2 (tGFP-tagged) - Mouse anterior gradient 2 (Xenopus laevis) (Agr2) |
USD 500.00 |
|
MR201533 | Agr2 (Myc-DDK-tagged) - Mouse anterior gradient 2 (Xenopus laevis) (Agr2) |
USD 300.00 |
|
MR201533L3 | Lenti ORF clone of Agr2 (Myc-DDK-tagged) - Mouse anterior gradient 2 (Xenopus laevis) (Agr2) |
USD 600.00 |
|
MR201533L4 | Lenti ORF clone of Agr2 (mGFP-tagged) - Mouse anterior gradient 2 (Xenopus laevis) (Agr2) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review