Pitx1 (NM_011097) Mouse Untagged Clone

CAT#: MC200808

Pitx1 (untagged) - Mouse paired-like homeodomain transcription factor 1 (Pitx1), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Pitx1 (NM_011097) Mouse Untagged Clone
Symbol Pitx1
Synonyms Bft; P-OTX; Potx; Ptx1
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC012696 sequence for NM_011097
CCACGCGTCCGCCCGAGCCTTAGAAACCGGCCTCGAATCGGGACTGGGGCCCGGGCCGGCCGGGCAGCTG AGGCCGGAGCAGCAGGAGCGCGTGGCGGAGCCCCGAGCCCCGAACCCGGTCCCGCAGCCTGGAGAGGTCG ATGGAGCTCGAACGGCGTCGCTGTGGGCGCGGGCAGCCCTGGGGGGCAGCCGCTTAGGCGCCACTCTCTT GTCCCCAACAGGTCGCAGCCTGGGCGGCCGGGAGCTCCCAGCCCCGGCCCCTGGAGCGCCCGTTGCGGTC CCCACCTCCATGGACGCCTTCAAGGGAGGCATGAGCCTGGAGAGGCTACCGGAGGGGCTGCGGCCACCGC CACCACCACCGCACGACATGGGGCCCAGCTTCCACCTGGCCCGCGCCGCCGACCCCCGGGAGCCGCTGGA GAACTCCGCCAGCGAATCGTCCGACGCTGATCTGCCAGACAAGGAGCGCGGTGGGGAAGCCAAGGGGCCA GAGGATGGTGGCGCGGGCAGTGCTGGCTGCGGCGGCGGTGCAGAGGACCCAGCTAAGAAGAAGAAACAGC GGCGGCAACGCACTCACTTCACAAGCCAGCAGTTGCAAGAGCTGGAGGCCACGTTCCAAAGGAACCGCTA CCCCGACATGAGCATGAGAGAGGAGATCGCGGTGTGGACCAACCTCACTGAACCGCGAGTGCGGGTCTGG TTCAAGAACCGGCGAGCCAAATGGCGCAAGCGGGAGCGGAACCAGCAGTTGGACCTGTGCAAGGGCGGCT ATGTGCCGCAGTTCAGCGGCCTGGTGCAGCCCTACGAGGACGTGTACGCTGCCGGCTACTCCTACAACAA CTGGGCGGCCAAGAGCCTGGCCCCGGCGCCGCTGTCTACCAAGAGCTTTACCTTCTTCAACTCCATGAGC CCGCTCTCCTCTCAATCCATGTTCTCGGCCCCCAGCTCCATCTCTTCCATGACCATGCCGTCCAGCATGG GCCCGGGCGCCGTGCCCGGCATGCCCAACTCGGGCCTCAACAACATCAACAACCTCACCGGCTCCTCGCT CAACTCGGCCATGTCGCCGGGCGCCTGCCCCTACGGCACCCCAGCCTCGCCCTACAGCGTCTACCGGGAC ACGTGCAACTCGAGCCTTGCCAGCCTGCGGCTCAAGTCCAAGCAGCACTCGTCGTTTGGCTATGGCGGTC TGCAGGGTCCGGCGTCGGGGCTCAACGCTTGCCAGTACAACAGCTGACCGCCCCGCCTGGTCCCCGGGGC CGCCGGCCAGCAAGGCTCACAGAAGGGAGCGCGCGGGAGCACGCGGGGCGCTCGCAGCTCCTCGGACCTC ACCTCTGCGCAGCCCCTTCCTCCCCACCCCGCCTCCAGGTTGGTTTTGTGTTTGCTTTTTCCAGACCCCC GCTCTGTCCCCCAATGAATGAAAAGAAAAGAAAGCAAGCCAAGGGAGGGGGTCGGGTGGGGAAGAAAGAA AAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_011097
ORF Size 948 bp
Insert Size 948
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC012696, NP_035227
RefSeq Size 1494
RefSeq ORF 948
Locus ID 18740
Cytogenetics 13 B1|13 30.06 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.