Eif4a3 (BC012862) Mouse Untagged Clone

CAT#: MC200683

Eif4a3 (untagged) - Mouse eukaryotic translation initiation factor 4A, isoform 3 (cDNA clone MGC:6715 IMAGE:3585696), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Eif4a3
• Synonyms: MGC6715, MGC6664, mKIAA0111
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC012862
  GCGGCTTGCAGTTGTCTTTCTGCGGAATCCGGATCATGGCGGCTAACGCCACGATGGCGACGTCTGGCTC GGCGCGGAAGCGGCTGCTCAAAGAGGAGGACATGACCAAAGTGGAGTTCGAGACGAGCGAGGAGGTGGAC GTGACCCCCACGTTCGACACCATGGGCCTGCGAGAGGACCTGCTGCGCGGCATCTACGCCTACGGTTTTG AAAAACCTTCAGCGATTCAGCAGCGTGCTATCAAGCAGATAATTAAAGGGAGAGATGTCATTGCACAGTC TCAGTCTGGCACAGGCAAGACGGCCACCTTCAGTGTCTCAGTGCTGCAGTGCTTGGATATCCAGGTTCGA GAAACCCAAGCTTTGATCCTGGCTCCAACCAGGGAGTTAGCGGTGCAGATTCAGAAGGGTCTGCTCGCGC TGGGGGATTACATGAACGTGCAGTGCCATGCCTGCATTGGGGGCACCAACGTCGGCGAGGACATCCGGAA GCTGGACTACGGACAGCACGTGGTGGCAGGCACGCCGGGACGCGTCTTTGATATGATCCGCCGGAGAAGT TTACGGACACGGGCTATCAAGATGCTGGTTTTGGATGAGGCTGATGAAATGTTGAACAAAGGTTTCAAGG AGCAGATCTATGATGTGTACAGGTACTTGCCACCAGCCACACAGGTCGTCCTCATCAGCGCCACACTGCC TCATGAGATCCTGGAGATGACCAACAAGTTCATGACCGACCCCATCCGCATCTTGGTGAAGCGTGATGAG TTGACTCTGGAAGGCATCAAACAGTTCTTTGTGGCTGTGGAAAGAGAGGAATGGAAATTTGATACTCTAT GTGATCTCTATGACACGCTGACCATCACCCAGGCCGTCATCTTCTGCAACACCAAGCGGAAGGTTGACTG GCTGACAGAGAAAATGAGAGAAGCCAATTTCACTGTGTCGTCCATGCATGGAGACATGCCCCAGAAAGAA CGAGAGTCTATCATGAAGGAGTTCCGGTCAGGTGCCAGCCGGGTGCTCATCTCCACAGACGTCTGGGCCC GGGGCCTGGATGTCCCTCAGGTGTCCCTCATCATTAACTACGACCTGCCCAACAACAGAGAACTGTACAT TCACAGAATTGGGAGATCGGGTCGGTATGGACGAAAAGGTGTGGCCATCAATTTTGTGAAGAATGATGAC ATCCGGATTCTCAGGGACATTGAGCAGTACTACTCCACCCAGATAGACGAGATGCCCATGAATGTGGCTG ACCTCATCTGAAGCTGGTGCTGGTGCACCGAGGCCCTGTTTGGAAACGGAAGCTTCTATTTAATGGGGTT GATATGGACTGTCTTCTCGGAGCCCCTCGGGAAGACAGTCAGCCCCGGCCATCTTTCCTAATGCACATGT ACATAATCCGATGCTTAACCTTTTACATTAAACGTGGACATTTTCCTGTGAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: BC012862
• Insert Size: 1236 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC012862, AAH12862
• RefSeq Size: 1488 bp
• RefSeq ORF: 1236 bp
• Locus ID: 192170
• Cytogenetics: 11 E2
• Gene Summary: ATP-dependent RNA helicase. Involved in pre-mRNA splicing as component of the spliceosome. Core component of the splicing-dependent multiprotein exon junction complex (EJC) deposited at splice junctions on mRNAs. The EJC is a dynamic structure consisting of core proteins and several peripheral nuclear and cytoplasmic associated factors that join the complex only transiently either during EJC assembly or during subsequent mRNA metabolism. The EJC marks the position of the exon-exon junction in the mature mRNA for the gene expression machinery and the core components remain bound to spliced mRNAs throughout all stages of mRNA metabolism thereby influencing downstream processes including nuclear mRNA export, subcellular mRNA localization, translation efficiency and nonsense-mediated mRNA decay (NMD). Its RNA-dependent ATPase and RNA-helicase activities are induced by CASC3, but abolished in presence of the MAGOH-RBM8A heterodimer, thereby trapping the ATP-bound EJC core onto spliced mRNA in a stable conformation. The inhibition of ATPase activity by the MAGOH-RBM8A heterodimer increases the RNA-binding affinity of the EJC. Involved in translational enhancement of spliced mRNAs after formation of the 80S ribosome complex. Binds spliced mRNA in sequence-independent manner, 20-24 nucleotides upstream of mRNA exon-exon junctions. Shows higher affinity for single-stranded RNA in an ATP-bound core EJC complex than after the ATP is hydrolyzed. Involved in the splicing modulation of BCL2L1/Bcl-X (and probably other apoptotic genes); specifically inhibits formation of proapoptotic isoforms; the function is different from the established EJC assembly. Involved in craniofacial development.[UniProtKB/Swiss-Prot Function]