Timm50 (BC010303) Mouse Untagged Clone

CAT#: MC200682

Timm50 (untagged) - Mouse translocase of inner mitochondrial membrane 50 homolog (yeast) (cDNA clone MGC:11857 IMAGE:3597676), (10ug)

  View "BC010303" in other vectors (10)

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Timm50 (BC010303) Mouse Untagged Clone
Symbol Timm50
Synonyms TIM50L
Vector pCMV6-Kan/Neo
Sequence Data
>BC010303
GGCGGCTCTGTTCTCGCGCTTGCGGAGCGGGCTCCGGGTAGGCGCGCGGGGGCTGTGCACGCGGCTAGCG CCGCCACCTCCCCGCACTCCCGAGCAGGTCACTGAAATTGCCAACCGTGGGGGCTCCAAGGCCCAGGGGC CACAGCACCAGCCAGGCTCCGAGGGTCCCAGCTATGCCAAAAAAATTGCGCTCTGGATCGCCGGTTTGCT CGGAGCTGGTGGGACTGTCAGCATCGTCTATATTTTTGGAAACAACCCTGTGGATGAAAATGGTACCAAG ATTCCTGATGAATTCGACAGCGATCCAATTCTGGTTCAGCAGTTGCGCCGGACATACAAATACTTCAAAG ATTACAGACAGATGATCATCGAGCCCACCAGTCCCTGCCTTCTCCCAGACCCTCTGCGGGAGCCCTACTA CCAGCCACCTTATACACTGGTCCTGGAGCTTACCGGGGTCCTTCTGCACCCAGAGTGGTCGCTGGCCACT GGCTGGAGGTTTAAGAAGCGTCCAGGCATCGAGACCTTGTTCCAGCAGCTTGCCCCTCTGTATGAAATAG TCATCTTCACATCAGAGACTGGCATGACTGCATTTCCACTCATTGATAGTGTGGACCCTCACGGTTTCAT CTCCTACCGTCTGTTCCGGGACGCCACCAGATATATGGAGGGACATCATGTGAAGGACATCTCCTGTCTG AATCGGGACCCAGCCCGAGTAGTAGTCGTGGACTGCAAGAAGGAAGCTTTCCGCCTCCAGCCCTTCAACG GTGTTGCCCTGCGGCCCTGGGATGGCAACTCAGATGACCGGGTCTTGCTGGACCTGTCTGCCTTCCTCAA GACCATTGCACTGAACCAAGTGGAGGACGTCCGGACGGTGCTGGAGCACTATGCTCTAGAGGATGACCCA CTGGAGGCATTCAAACAGCGGCAGAGCCGGCTTGAGCAGGAGGAGCAGCAGCGCCTGGCCGAGCTCTCCA AGTCCAACAGGCAGGGCCTCTCCTTTGGCTCACTCGCCAGCCGACTGTGGCCTCGCTCCAAGCAGCCCTG ACTTCTAGGCTTCCTCAGAGACTTGATGCCTGAGCCTTGGGCCCCAGCCCTTACACGGCAAAGTGTGGAC AGCTATGTGTCCAATAAAGCGAGTCCCAGATGCCACAATGCCTGTGTCCAGAGTCCAGATGGGGCACTGG GGTGAGGTCTTGGACTCGGTCGTCATTCACAGTGACTGAGCACCACCACAGGGCTGGGTGCCATGAGTGC CTCGTTGGAGTGGGGCTCCTGCCAGCCTGAAACTGAAAACCTGGGTTTCTGCTGCACATGTCTTCCCATA TACTCTATGAGTTGGCAAAGAAAAGCCCCTCTCTCTCTCCCTCCCTCTTTCTCTGGCTCTGGACTCCTTG TGTGCTGTAGAAATAAAGAGAAGTCTGGCCTCTGGGGAGCCGCCTCGAGGGCTGTCAGCCTAAAAAAAAA AAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC010303
ORF Size 690 bp
Insert Size 690
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC010303,
RefSeq Size 1487
RefSeq ORF 690
Locus ID 66525
Cytogenetics 7|7 A3

Other Versions

Other products for "Timm50"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies