Tuba1b (BC008117) Mouse Untagged Clone

CAT#: MC200606

Reviews ()
Write a review

Tuba1b (untagged) - Mouse tubulin, alpha 1B (cDNA clone MGC:7731 IMAGE:3498312), (10ug)

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Tuba1b (BC008117) Mouse Untagged Clone
Symbol Tuba1b
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Sequence Data
>BC008117
CGACTCTTAGTTGTCGGGAACGGTAACCGAGACCCGGTGTCTGCTTCTATCTCTCACCCTCGCCTTCTAA CCCGTTGCTATCATGCGTGAGTGCATCTCCATCCACGTTGGCCAGGCTGGTGTCCAGATCGGCAATGCCT GCTGGGAGCTCTACTGCCTGGAACATGGCATCCAGCCTGATGGCCAGATGCCAAGTGACAAGACCATTGG GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGAGCTGGCAAGCATGTGCCCCGGGCAGTG TTCGTAGACCTGGAACCCACGGTCATCGATGAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCATCCTG AGCAGCTCATCACAGGCAAGGAGGATGCTGCCAATAACTATGCCCGTGGCCACTACACCATTGGCAAGGA GATCATTGACCTTGTCCTGGACAGGATTCGCAAGCTGGCTGACCAGTGCACGGGTCTCCAGGGCTTCTTG GTTTTCCACAGCTTTGGCGGGGGAACTGGCTCTGGCTTCACCTCCCTGCTGATGGAGCGGCTCTCTGTGG ATTACGGAAAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACTGCTGTGGTTGA GCCCTACAATTCCATCCTCACCACCCACACCACCCTGGAGCACTCTGATTGTGCCTTCATGGTAGACAAT GAGGCCATCTATGACATCTGTCGTAGAAACCTCGACATTGAGCGCCCAACCTACACCAACCTTAACCGCC TTATTAGCCAGATTGTGTCTTCCATCACTGCTTCCCTCAGATTTGATGGGGCCCTGAATGTTGATCTGAC AGAATTCCAGACCAACCTGGTACCCTACCCTCGCATCCACTTCCCTCTGGCCACTTATGCCCCTGTCATC TCTGCTGAGAAAGCCTACCATGAGCAGCTTTCTGTAGCAGAGATCACCAATGCCTGCTTTGAGCCAGCCA ACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCTTGCTGCCTGCTATACCGTGGTGATGT GGTTCCCAAAGATGTCAATGCTGCCATTGCCACCATCAAGACCAAGCGCAGCATCCAGTTTGTAGACTGG TGCCCCACTGGCTTCAAGGTTGGCATTAATTACCAGCCTCCCACTGTGGTACCCGGTGGTGACCTGGCCA AGGTGCAGAGAGCTGTGTGCATGCTGAGCAACACCACAGCCATTGCTGAGGCCTGGGCTCGCCTAGATCA CAAGTTTGATCTGATGTATGCCAAGCGTGCCTTTGTGCACTGGTATGTGGGTGAGGGCATGGAGGAGGGT GAGTTCTCTGAGGCCCGTGAGGACATGGCTGCCCTAGAGAAGGATTATGAGGAGGTTGGTGTGGATTCTG TGGAAGGCGAGGGGGAGGAAGAAGGAGAGGAGTACTAAGTCCATTCCTTGAGCCCCCTGTGTCGTCAAAC TGCTCCAGTATTAGTTGCAGGCACTGATGCTTCTGTGCTGTTTCCATTCTGTGATCATGTCTTCTCCATG TTGTACCTCTTAAGTTTTCCATGATGTCTCAAAGTAAAAGCTTTAAGAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC008117
ORF Size 1356 bp
Insert Size 1356
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC008117
RefSeq Size 1628
RefSeq ORF 1356
Locus ID 22143
Cytogenetics 15 F1
Gene Summary Tubulin is the major constituent of microtubules. It binds two moles of GTP, one at an exchangeable site on the beta chain and one at a non-exchangeable site on the alpha chain. [UniProtKB/Swiss-Prot Function]
Other products for "Tuba1b"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones