Ralb (NM_022327) Mouse Untagged Clone

CAT#: MC200565

Ralb (untagged) - Mouse v-ral simian leukemia viral oncogene homolog B (ras related) (Ralb), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Ralb (NM_022327) Mouse Untagged Clone
Symbol Ralb
Synonyms 5730472O18Rik
Vector pCMV6-Kan/Neo
Sequence Data
>BC006907 sequence for NM_022327
CGGACGCGTGGGTGCGCATAGCCAGAGCGGCGGTGGGACGGCTCCCCCAGCTCCTCACCTGGGCCACCTG TCCGTGTGTCACCACCTCCGACCAGCAGGATGGCTGCCAACAAGGGCAAGAGCCAGGGCTCCCTGGTACT TCACAAGGTCATCATGGTTGGCAGTGGAGGGGTCGGCAAATCAGCCCTGACGCTTCAGTTCATGTATGAT GAGTTTGTAGAAGACTATGAGCCCACCAAAGCTGACAGTTACAGAAAGAAGGTGGTTCTCGACGGAGAAG AGGTCCAGATAGACATCCTGGACACCGCTGGCCAGGAGGACTATGCGGCCATCCGTGACAACTACTTCCG AAGCGGAGAAGGCTTTCTGCTGGTGTTCTCCATCACAGAGCACGAGTCTTTCACAGCCACAGCCGAGTTC AGGGAACAGATTCTCCGAGTCAAGTCAGAGGAGGACAAGATCCCACTGCTGGTCGTGGGCAACAAGTCCG ACCTGGAGGAGCGGAGGCAGGTGCCTGTGGACGAGGCCCGAGGCAAAGCGGAGGAGTGGGGTGTGCAGTA CGTGGAGACATCTGCAAAGACCCGCGCCAATGTGGACAAGGTATTCTTTGATCTGATGAGAGAAATCCGG GCAAAAAAGATGTCAGAAAACAAGGACAAGAACGGCAGGAAAAGCAGCAAGAGCAAGAAAAGTTTCAAAG AGCGATGCTGCTTGCTGTGAGCGGGCTGCAGACTGACGCAGCAGAGTGGGCCACACTGCAGCGCAGCGAG CCGGAGGTGGCCTCCCAGCTGGCTCCCCATTCGCTCTCCACAACTGCATTCACTATCACTTCTTGAGATG GGACAGATATCCGTGCGTCAGTGGCTGGCAGAAGAAAGACGCCTTTGTCTGTGTAATGCCTCTGTTAACT TTGCCAGGAGCTTTGAGAGTCTGCCCTCTCCCACCCTTCCTGAACCATGACCACCACCAGCTCTAGGGTC GTAATGTTGGAGATCAGGAATATTGGTTGTGATGACAAGAAAGAGCCCACTTACTCCTCCTCGTTCTAGG ACACGGTCATCTTTCCTTAGGAAATTAAAATGCTTCATATTATCTGGGCATGGTGGTGCACCCCTGTAGT CTCAGAACTCTAGAAGGTAAGGCAGGGAGGGTAGCCTGAGCCCAAGGCCAGCCTGGGCTACCTAACAAGA CCCTGTCTCTAAAAGAAAAAAGAATTAACATCTTATTTTCTTAGATTTTAAGAGAGAGTCTCTGGCAAGA CCCCCCTCATCAGTTCTAATCATTTTAGAAGTAGACAGAAAAAAATATCTAAGCTCAGGTAATACTGAAA AAGCCAAAATGTTTTGTTTCGTTTCTTTTTTTTTTTTTTTTTTAAAGATAAACTTGTGTAGTTTGGAAGC AGATTTAGAAAGATGAACTTCACTTGGGCCAGATAGGCTGAACCAAGCTTCCTGGCGTTTGTAGAGAAAG TGGGACGCTGTTCTCTTCATATTTAAATGCCAGCCAGGTGCTGGCTGTGGGCTTTCCCTCCTCAACACCC TTATTTAGAAAGGAAACTGTGTGGGGGGAGATGCAGGCCTGAGCCCCATAGCGAGCTTGCCTTTTCTGAC TGGGTCTTCTGGTCCCCCCTACACCAGCCATAGGCCTGTTCTTTTTCTTCCTTCTGAAAACTGTGACCAG TTCAAATTATGACTCAGAACGTAGGGCCAGCACCAGCTACCTCTGCAGACTCCCAGTGACTCTCTCTTCA CAAGCAGATGAAGGGAAGGCTCAGAAGGGCATCTCCTGTAGCTCCTGGCAGCTGGTTCTGGTGGCACTGA GATGAGTGCCACCAGAGGCTCACACTCACTCTCTGTTGAGCTTCTTCCCAGGGAAGGGGATTCTGGGACA GGGGGCTGCCACTAAGCACACACACTCCTCCTATTTTCCAGAAGTGAACATTTCATGTTTAGGTGCCGAA TGTGAATCTGGGTGGGGAGAGCGGGAGCCCTTCGAATGGATTTTTTTTTTCTTTTTTTACAGAGGTTATG GGAACTAAGGTCTGATCCCTGGAAACTGATCTTGTGTCACTTCCAAAGAATCATGGGCTTTTTCGAATAA AAAAATTTACACTTTTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_022327
ORF Size 621 bp
Insert Size 621
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC006907, NP_071722
RefSeq Size 2132
RefSeq ORF 621
Locus ID 64143
Cytogenetics 1|1 E2.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.