Vps29 (NM_019780) Mouse Untagged Clone

CAT#: MC200554

Vps29 (untagged) - Mouse vacuolar protein sorting 29 (S. pombe) (Vps29), (10ug)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Vps29 (NM_019780) Mouse Untagged Clone
Symbol Vps29
Synonyms 2010015D08Rik; AW049835; PEP11
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC005663 sequence for NM_019780
GGAAGAGGGCGGCGGCGTTCGTGGTGATTGTACGGAGCCCTGGTGACAGGATGTTGGTGTTGGTACTAGG AGATCTGCACATTCCGCACCGGTGCAACAGCCTGCCGGCCAAGTTTAAAAAACTCCTGGTGCCAGGAAAA ATCCAGCACATCCTCTGCACCGGCAACCTCTGCACCAAGGAGAGCTACGACTATCTCAAGACTCTGGCTG GCGACGTCCACATCGTGAGAGGAGACTTCGATGAGAATCTGAATTACCCAGAACAAAAGGTTGTGACTGT GGGCCAGTTCAAGATCGGTCTGATTCACGGACACCAAGTTATTCCGTGGGGAGACATGGCTAGCTTAGCC CTGCTGCAGAGGCAGTTTGATGTGGACATTCTTATCTCAGGACACACACACAAATTTGAAGCATTTGAGC ATGAAAATAAATTCTACATTAACCCAGGTTCTGCCACTGGGGCCTATAATGCCTTGGAAACAAACATTAT TCCATCGTTTGTGCTGATGGACATCCAGGCTTCTACTGTGGTCACTTACGTTTATCAACTAATTGGAGAT GACGTCAAAGTAGAACGAATTGAGTATAAAAAGTCGTAAAGCCAGGCTGGTCTCCACCACTTATTTTGTC CTCATTTCATTGTTTAAATCAAATAATTAAACACTTAAGAGGCACACAGTTGTATCACTTTTATAATACT TTGCACTAAAAAGTCTTCTCTGTTAATCCATAGTTGCTCTAAAGCTTCTTGTAAACTGTTAAGAATATAT TTAGTTTGCAGTGTATGGTTTCTGTAAGAAGCAGCCCACCCAACAGTGCAGGGCCACTTTAGGAAGTTGT CCTTGTAAATAGCCTCCTACTTGGTATTTGGACTTCATTACAAAACTAGCGCATGAAGAGAAAGAATCCA GACTTTGTGTGTATGTTTTCTCTTCTCTGGTAATAAATGTGTACCTTCCATTTAAAAAAAAAAAAAAAAA AAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_019780
ORF Size 549 bp
Insert Size 549
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC005663, NP_062754
RefSeq Size 985
RefSeq ORF 549
Locus ID 56433
Cytogenetics 5|5 F
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.