Rrp15 (NM_026041) Mouse Untagged Clone

CAT#: MC200496

Rrp15 (untagged) - Mouse ribosomal RNA processing 15 homolog (S. cerevisiae) (Rrp15), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rrp15 (NM_026041) Mouse Untagged Clone
Symbol Rrp15
Synonyms 2810430M08Rik; 5430437H21Rik
Vector pCMV6-Kan/Neo
Sequence Data
>BC006787 sequence for NM_026041
CTTCCGGCGAGCCAAGATGGCTGCGGCCGTTCAGGACTCACGTGTGAGCCCAGGGGAGATGCTGAAGCGT TCCCCGAAGAAGAAGAAAAAGATGAAGATGGTAGCCAAGGCTGCGGCGTCGAAGCTAGAAGATGAGGTCA AAGACTCTTCTGATGGAGAAGGAAGCTGTGACTCAGACATGGACCACTCAGATGATGGAGCTGCAGAAGC AGACAGTGAGGACAATGTTGAATCCTGTGAGGAAGACAATGAAGACGCTGCAGAGTCGAGTGCTGGGACC AATTCAGGCTGGGCAGATGCCATGGCAAAAATCCTTAACAAAAAGACTCCTAAAAGCAAAGCCACCATCC TCACCAAAAACAAAGAGCTGGAGAAGGAGAAGGAGAAGCTAAAGCAGGAGAGGCTGGAGAAAAGGAAGCA GCTTGATAAGAAGCGGGAGTGGGAAATGCTGTGCAGAGTGAAGCCAGATGTTGTCAAAGACAAAGAGGCA GAGAGGAACCTTCAGAGGATTGCGACAAGGGGTGTGGTGCAGCTCTTCAATGCTGTTCAGAAACACCAAA GGAATGTTGGCGAAAAGGTTAAGGAAGCGGGAGGCTCCGTCCGCAAGCGAGCCAAGCTGATGTCAACTGT TTCCAAGAAGGATTTCATCAGTGTTCTTCGAGGAATGGATGGTACAAGTAGGAACAGTCCTGCTGGGAAG AGCCCCAAAGCCAGACAGACTGAAGTGAAATCAGAAGAGAGCCCAGGGTGGAAGATTCTGCGAGATGATT TCATGATGGGAGCCAGCATGAAGGACTGGGACAAGGAGAGCGAGGGCGAGGAGCCTGCTGGTGGCAGGGC AGAGGCCGCAGCCAGCCGTTAAGCGGCAGACGGGAGCATCCAGCTCCGCTGCAAATGACCCGACGGTTGG GAGCCTGCGGATGGCCATCTGCCAAATGCTAGGACTTCCTGAGAACCTGTGCTCTAGGGTTCCTCAGGTG CAGACTGTATTAAAGCTGTATTTTTAATTCTTACAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_026041
ORF Size 846 bp
Insert Size 846
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC006787, NP_080317
RefSeq Size 1040
RefSeq ORF 846
Locus ID 67223
Cytogenetics 1|1 H5
Gene Summary This gene encodes a protein similar to budding yeast Rrp15p. Rrp15p is a component of pre-60S ribosomal particles in budding yeast, and is required for the early maturation steps of the 60S subunit. The mouse genome contains at least one pseudogene on the X chromosome. [provided by RefSeq, Jul 2008].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.