Slc40a1 (NM_016917) Mouse Untagged Clone

CAT#: MC200443

Slc40a1 (untagged) - Mouse solute carrier family 40 (iron-regulated transporter), member 1 (Slc40a1), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Slc40a1 (NM_016917) Mouse Untagged Clone
Symbol Slc40a1
Synonyms Dusg; Fpn1; IREG1; MTP; MTP1; Ol5; Pcm; Slc11a3; Slc39a1
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC003438 sequence for NM_016917
GCGAGAGCAGGCTCGGGGTCTCCTGCGGCCGGTGGATCCTCCAACCCGCTCCCATAAGGCTTTGGCTTTC CAACTTCAGCTACAGTGTTAGCTAAGTTTGGAAAGAAGACAAAAAGAAGACCCCGTGACAGCTTTGCTGT TGTTGTTTGCCTTAGTTGTCCTTTGGGGTCTTTCGGCATAAGGCTGTTGTGCTTATAGTGGTGCTATCTT CGGTTCCTCTCACTCCTGTGAACAAGCTCCCGGGCAAGAGCAGCTAAAGCTACCAGCATCAGAACAAACA CGGGGAGAACGCCTGGTGTCATGACCAAGGCAAGAGATCAAACCCATCAGGAAGGATGCTGTGGATCCTT AGCAAACTACCTGACCTCAGCAAAATTCCTCCTCTACCTTGGCCACTCTCTCTCCACTTGGGGGGATCGG ATGTGGCACTTTGCAGTGTCTGTGTTTCTGGTGGAACTCTATGGAAACAGCCTTCTCTTGACAGCTGTCT ATGGACTGGTGGTGGCAGGCTCTGTTCTGGTCCTGGGAGCCATCATTGGTGACTGGGTGGATAAGAATGC CAGACTTAAAGTGGCCCAGACGTCACTAGTGGTTCAGAATGTGTCCGTCATCCTCTGCGGAATCATCCTG ATGATGGTTTTCCTACACAAGAATGAGCTCCTGACCATGTACCATGGATGGGTCCTTACTGTCTGCTACA TCCTGATCATCACTATTGCAAACATTGCAAATTTGGCCAGTACTGCCACTGCGATCACAATCCAAAGGGA CTGGATTGTTGTTGTGGCAGGAGAAAACAGGAGCAGATTAGCAGACATGAATGCTACCATTAGAAGGATT GACCAGCTAACCAACATCCTGGCCCCCATGGCTGTCGGCCAGATTATGACATTTGGTTCTCCAGTCATTG GCTGTGGTTTCATTTCCGGTTGGAATTTGGTGTCCATGTGTGTGGAGTACTTCTTGCTCTGGAAGGTTTA CCAGAAGACCCCTGCTCTGGCTGTAAAAGCTGCTCTCAAGGTAGAGGAGTCAGAACTGAAGCAGCTGACC TCACCTAAAGATACTGAGCCAAAACCTTTGGAGGGAACTCATCTAATGGGTGAGAAAGACTCCAACATCC GTGAACTTGAATGTGAACAAGAGCCCACCTGTGCCTCCCAGATGGCAGAGCCCTTCCGCACTTTCCGAGA TGGATGGGTCTCCTACTATAACCAGCCAGTGTTTCTGGCTGGCATGGGCCTGGCTTTCCTCTATATGACA GTCCTGGGCTTTGACTGTATCACTACAGGGTACGCCTACACTCAGGGGCTGAGTGGATCCATCCTTAGTA TTTTGATGGGAGCATCAGCAATAACTGGAATAATGGGAACTGTGGCCTTCACCTGGCTACGTCGAAAATG TGGCCTTGTTCGGACTGGTCTATTCTCAGGACTAGCCCAGCTTTCCTGTTTAATCTTGTGTGTGATCTCC GTATTCATGCCTGGAAGCCCCTTGGACCTGTCTGTTTCTCCATTTGAAGATATCCGTTCTAGGTTTGTGA ATGTGGAGCCAGTGTCCCCAACTACCAAAATACCTGAGACCGTCTTTACAACAGAAATGCATATGTCCAA CATGTCTAATGTCCATGAGATGAGTACTAAACCCATCCCCATAGTCTCTGTCAGCCTGCTGTTTGCAGGA GTCATTGCTGCTAGAATCGGTCTTTGGTCCTTTGATTTGACGGTGACACAGTTGCTGCAAGAAAATGTAA TTGAATCTGAAAGAGGCATTATCAATGGTGTGCAGAACTCCATGAACTACCTTCTTGACCTTCTGCATTT CATCATGGTCATCTTGGCCCCAAATCCTGAAGCTTTTGGCTTGCTGGTATTGATTTCAGTCTCCTTTGTG GCAATGGGACATCTTATGTATTTCCGATTTGCCCAGAAGACTCTGGGCAACCAGATTTTTGTTTGTGGTC CTGATGAAAAAGAAGTTACAGATGAAAATCAACCGAATACATCTGTTGTATAAAAATAGTTTAGCTGTGG CCCCTGTTACTAGATTGTGGAGAGCATGTGTGCTTATTTTGTACTGCAGAATCCCAATAAATGCCTGCAT TTCTCTCTGGTTTTACCACCTCTGTGCCTTAAGGGCTAGGAGCACTAACTAACCATCGCCAGCAAAGATG GTTATTTCTCCTTACATGTAAACATGGGAAAATAGGAAGAGGGAGAGGCAGTCAGCGTGTGTATAGAAAG GGCTTAATGGTAAAATGAACTTCCCTTACTCTTATAAGTATATTAAATTTTGAAGAGTGGTTGTCAGGTG AGTAAAATTATTCCTTAGCAGATATTTATTATCTACTAGAATAATAAATCAATTCACCCTAAAACTCACT CTTGTAAAAGTCTGCCCCACTTCCTTTTTTAAGATCAGTGATATTTTTCTCAGTTACATTACAGAAACAA GTTTTTCCTCCATGTATGAAGGTTATAGTTAGATAATGAGTGTTATCCTTATTAATCCCATTGAACTTAA GGAATTTATTGTATGTGGAGGATGAAATGTGTAACTAGACTTGTCCAAAAGGTTCATGGAATAACTTTTG CATTTTGACCATCAGAAAGGGCAAAATATTACAGTAATGTGTGTATGGTGGCTCTTCATAAAATGACTCT CAAAATCTGCAGAAAGAAGAAAAGTTGTAGGTTTCTAGTGTGGTACAGAAGGACTTAAGGCTTGTTATTA GTGTGATTGTAGAAACTGGAAGCTAAGGGTGAGGACCTCATGTAACCAGAGTCACTGTCATCAGCCATCA CTATCTATCTTGGTAAATGAGAGAGCTGACCTGGCACCTTACAGGCAGAAAAGCGGCCCACACTAAGAAA GGACTGCAAATCAGTGAGTCTGTATAGAACATTTTACCTTCACTGACTTGGGCCGATGTGTTTGTCATCT CTGTGTTTTTCTAGAGCAACAATAGTCACAAAAGTTCCCCTTTCAATATCCCTGAGAAGAATAAAGAAAA AACTGTTTGTAAATATTTTTTTAAAACTGTTCTGCAAGTCTTTTTGTAACATGCAGTACCAACATGGGAC ATTGCCTTAACTTTTGATGCACTTTCATGGAGACTGACTGCCATGCATTGCTGTGAGCACTTTCTTTGTC GTTCAGTTTAATCTTTTCCTTCACCTTTATTACAGTATGACATAATGATCTACTATGTTGTCAAAGCTTC ATAAAATATTTCTATATAAAATGTTTGTAGAATCTTCAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_016917
ORF Size 1713 bp
Insert Size 1713
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC003438, NP_058613
RefSeq Size 3273
RefSeq ORF 1713
Locus ID 53945
Cytogenetics 1|1 C1.1
Gene Summary May be involved in iron export from duodenal epithelial cell and also in transfer of iron between maternal and fetal circulation. Mediates iron efflux in the presence of a ferroxidase (hephaestin and/or ceruloplasmin). [UniProtKB/Swiss-Prot Function]
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.