Mat2a (NM_145569) Mouse Untagged Clone

CAT#: MC200423

Mat2a (untagged) - Mouse methionine adenosyltransferase II, alpha (Mat2a), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Mat2a (NM_145569) Mouse Untagged Clone
Symbol Mat2a
Synonyms D630045P18Rik
Vector pCMV6-Kan/Neo
Sequence Data
>BC003451 sequence for NM_145569
GCAGCCCTCCGCCTCGCCGCCTCTCAGTCTCCTCAGAGTCGCCCTCTCTCACCGCCGCCGCCATGAACGG GCAGCTCAACGGCTTCCACGAGGCGTTCATTGAGGAGGGGACGTTCCTCTTCACTTCCGAGTCTGTAGGG GAAGGTCACCCAGATAAGATTTGTGACCAAATCAGTGATGCTGTCCTTGATGCACACCTTCAACAAGACC CTGATGCTAAAGTGGCTTGTGAAACTGTTGCTAAAACTGGAATGATTCTTCTTGCTGGGGAAATTACATC CAGAGCTGCCATTGATTACCAGAAAGTGGTTCGTGAAGCCATAAAGCACATTGGATATGATGACTCTTCC AAAGGGTTTGACTACAAGACTTGTAATGTGTTGGTTGCCTTGGAACAACAGTCACCAGATATTGCCCAAG GTGTTCATCTTGACCGGAATGAGGAAGATATTGGTGCAGGAGACCAGGGTTTGATGTTTGGTTATGCCAC TGATGAAACTGAAGAGTGTATGCCTTTAACCATTGTCTTAGCACACAAGCTAAATGCCAAATTGGCTGAA CTACGCCGCAATGGTACATTGCCTTGGTTACGCCCAGATTCTAAAACTCAAGTGACTGTGCAATATATGC AAGATCGGGGTGCTGTGCTTCCCATCAGAGTCCACACGATTGTTATATCTGTTCAGCACGATGAAGAAGT TTGTCTTGATGAGATGAGGGATGCTCTGAAGGAGAAAGTGATCAAGGCTGTTGTACCTGCAAAATACCTT GATGAGGATACAATTTACCACCTACAGCCAAGTGGCAGATTTGTTATTGGTGGGCCTCAGGGTGATGCTG GCCTGACTGGCCGAAAAATCATTGTGGATACTTATGGCGGTTGGGGAGCTCATGGAGGAGGGGCCTTTTC AGGAAAGGATTATACCAAAGTGGACCGTTCAGCTGCTTATGCTGCTCGTTGGGTGGCAAAATCCCTTGTT AAAGGAGGTCTGTGCAGGAGGGTTCTTGTTCAGGTCTCTTATGCTATTGGAGTTTCTCATCCATTGTCGA TCTCCATTTTCCATTATGGCACTTCTCAGAAGAGTGAGAGAGAGCTATTAGAAATTGTAAAGAAGAATTT TGATCTTCGCCCTGGGGTCATTGTCAGGGATCTGGATCTGAAGAAGCCAATTTATCAGAGGACTGCAGCC TATGGCCACTTTGGTAGGGACAGCTTCCCATGGGAAGTGCCCAAAAAGCTTAAATATTGAAAGTGTTAGC CTTTTTTCCCCAGACTTGTTGGCGTAGGTTACAGAGAAGCCTTCAAGCTCTGAGGGAAAGGGCCTTCTTC CTAAATTTTTCTGTCCTCTTTCAGCTCCTGATCAGTTGCAGTCACTCTAATCAATGACATGAATTTTAGC TTTTGTGGGGGACTGTAAGTTGGGCTTGCTATTCTGTCCCTAGGTGTTTTGTTCACCATTATAATGGATA TAGTGAGCATAGGTGAGCCATGTAACTGCCTAGAAACAAACACTGTAGTGAATAATGCTTTGAAATCGAA CCTTTGTGCCCTATCACCTAATCCTCCAAAGTCCTAATTGCAATTACTTTCCCACCAGATGCTGAAAACA TCCTTGTAGTGTGCACGTAAAGTACTTGTAGTTTGACTGTAGACTCTGGCAATGCCACAGCCCTGTCAGC ATGAATCTGTAACGTCTTGAGCTCTATTTATTGAATGTGAAGCCCCTGTCCTTATCCTCCCTGTAACTCA TTTCTAATTATGTAGTTCTTTATCAGGGAGTGTTCCTATCCAATCAATCTTGCATGAAACGAAAGTTTCA GTTGGAGCTCTAGCCTGACTTTGAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_145569
ORF Size 1188 bp
Insert Size 1188
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC003451, NP_663544
RefSeq Size 1859
RefSeq ORF 1188
Locus ID 232087
Cytogenetics 6|6 C1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.