Msr1 (NM_031195) Mouse Untagged Clone

CAT#: MC200363

Msr1 (untagged) - Mouse macrophage scavenger receptor 1 (Msr1), transcript variant 1, (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Msr1 (NM_031195) Mouse Untagged Clone
Symbol Msr1
Synonyms MRS-A; MSR; MSR-A; Scara1; Scvr; SR-AI; SR-AII
Vector pCMV6-Kan/Neo
Sequence Data
>BC003814 sequence for NM_031195
ATAAATCAGTGCTGTCTTCTTTACCAGCAATGACAAAAGAGATGACAGAGAATCAGAGGCTCTGCCCTCA TGAACGAGAGGATGCTGACTGCAGTTCAGAATCCGTGAAATTTGACGCACGTTCAATGACAGCATCCCTT CCTCACAGCACTAAAAATGGCCCCTCCGTTCAGGAGAAGTTGAAGTCCTTCAAGGCTGCCCTCATTGCTC TCTACCTCCTTGTGTTTGCAGTACTAATACCTGTTGTTGGAATAGTGACAGCTCAGCTTTTGAATTGGGA AATGAAGAACTGCTTAGTTTGTTCACGTAACACAAGTGATACATCTCAAGGTCCTATGGAAAAAGAAAAT ACCAGTAACGTGGAAATGAGATTTACAATTATCATGGCACACATGAAGGACATGGAGGAGAGAATCCAAA GCATTTCAAACTCAAAAGCCGACCTTATAGACACGGGACGCTTCCAGAATTTCAGCATGGCAACTGACCA AAGACTTAATGATATTCTTCTGCAGTTAAATTCCTTGATTTTGTCAGTCCAGGAACATGGGAATTCACTG GATGCAATTTCCAAGTCCTTGCAGAGTCTGAATATGACACTGCTTGATGTTCAACTCCATACAGAAACAC TGCATGTCAGAGTCCGTGAATCTACAGCAAAGCAACAGGAGGACATCAGTAAATTGGAGGAACGTGTGTA CAAAGTATCAGCAGAAGTCCAGTCTGTGAAAGAAGAACAAGCGCACGTGGAACAGGAAGTAAAACAGGAA GTGAGAGTATTGAACAACATCACCAACGACCTCAGACTGAAGGACTGGGAACACTCACAGACACTGAAAA ACATCACCTTCATTCAAGGGCCTCCTGGACCCCAAGGTGAAAAGGGAGACAGAGGGCTTACTGGACAAAC TGGTCCACCTGGTGCTCCAGGAATAAGAGGTATTCCAGGTGTTAAAGGTGATCGGGGACAAATTGGCTTC CCTGGAGGTCGAGGAAACCCAGGAGCACCAGGAAAGCCAGGGAGGTCGGGATCTCCTGGACCTAAAGGAC AAAAGGGAGAGAAGGGGAGTGTAGGCGGATCAAGATCAGTATAACTCCCTGATCATATTGGGGCAAGACC CTTTTAAGATCAGCTGGGCTGGGCAGAGCACCCTACTATCATCTCCTTAAAAGACCTTTCACCTCTGGAC AAGTCATCAACACAAGTGACTTCTGGGATCCTTTTGCAACTCCTTCAAATGACATTGGTTCCTGTGTCAT GCCATGCCTGGCTTCTTGTAACTTCTTCTAACCCTGGGTGCTGTTGGGGCCTCCATTGACATAAGTACCT TATGGCATATGCTCTGCTACAATGACTCCCATCCCCTGGCACCTTTTACCTAGATGTTCTACCTGTTGAG TAGAGGGATGTTCCTGCCTTCTTCAGACCTTCTGCTGTTCCCCTCACCTAACTGTGCAGAATCCTATTAA ATTCTAAGAAAAACTTAATTGATATTGATTAAGTATTAGTTCTTGAAATGTAAGATATTTTCCTCAAATA CAAATAGAGATTGAAATAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_031195
ORF Size 1065 bp
Insert Size 1065
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC003814, NP_112472
RefSeq Size 1572
RefSeq ORF 1065
Locus ID 20288
Cytogenetics 8 A4|8 23.89 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.