Igl (BC002129) Mouse Untagged Clone

CAT#: MC200356

(untagged) - Mouse cDNA clone MGC:6743 IMAGE:3591831, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Igl
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC002129
  GAAGCAAAACCTGGGTGTTTTCACCATGACTTGGGCTCCACTACTCCTTGTCTTTCTTCATCACTTAACA GGGTCATGTGCCCAGCTTGTGCTTACTCAGCCAAGCTCTGTGTCTACGTCTCTAGGAAGCACAGCCAAAC TGCCTTGCAAGGCCAGCACTGGTAACATTGGAGACAGCTATGTGAACTGGTACCAGCAGTACATGGGAAG ATCTCCCACTAATATGATCTATGGAGATGATCTCCGACCATCTGGAGTTTCTGATAGGTTCTCTGGCTCC ATTGACAGCTCTTCCAACTCAGCCTTCCTGACAATCCAAAATGTGCAGGCTGATGATGAGGCTGACTACT ACTGTCAGTCTTATAGTAGTGGCATTCGGGTGTTCGGTGGAGGAACCAAACTGACTGTCCTAAGCCAGCC CAAGACTTCGCCATCAGTCACCCTGTTTCCACCTTCCTCTGAAGAGCTCGAGACTAACAAGGCCACACTG GTGTGTACGATCTCTGATTTCTACCCGGGTGTGGTGACAGTGGACTGGAAGGCAGATGGTACCCCTGTCA CTCAGGGTGTGGAGACAACCCAGCCTTCCAAACAGAACAACAACAAGTACATGGCTAGCAGCTACCTGAC CCTGACAGCAAAAGCATGGGAAACTCATAGCAGTTACAGCTGCCAGGTCACTCATGAAGGTCACACTGTG GAGAAGAGTTTGTCCCGTGCTGACTGTTCCTAGGTCATCTAACCTTCATCTTACCCACAGAGGCTGAGAT CAGAAACATGCCCAAGTGTATCCTTGATGCTTTTGCCTACCATAGCCCTTCTCTCTACCCTCAAAATGCA CAATAAAATGTTCATTCACAACCTGTTAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: BC002129
• Insert Size: 708 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC002129
• RefSeq Size: 893 bp
• RefSeq ORF: 708 bp
• Locus ID: 111519
• Cytogenetics: 16 A3|16
• Gene Summary: Immunoglobulins recognize foreign antigens and initiate immune responses such as phagocytosis and the complement system. Each immunoglobulin molecule consists of two identical heavy chains and two identical light chains. There are two classes of light chains, kappa and lambda. This region represents the germline organization of the lambda light chain locus from the C57BL/6J inbred mouse strain. The locus includes V (variable), J (joining), and C (constant) segments. During B cell development, a recombination event at the DNA level joins a single V segment with a J segment; the C segment is later joined by splicing at the RNA level. This locus has four J-C clusters and three V segments that constitute two transcriptional units. One of the J-C clusters is incapable of encoding a protein; the J and C gene segments in this cluster are considered pseudogenes. Inbred strains of laboratory mice lack an additional J-C cluster of pseudogenes and several additional V segments that are found in wild mice. [provided by RefSeq, Jul 2008]