Rab1a (NM_008996) Mouse Untagged Clone

CAT#: MC200352

Rab1 (untagged) - Mouse RAB1, member RAS oncogene family (Rab1), (10ug)


  "NM_008996" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
RAB1A Antibody - middle region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Rab1a"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Rab1a
Synonyms Gtbp; mKIAA3012; Rab-1; Rab1; Ypt1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002077 sequence for NM_008996
CGGACGCGTGGGGCGATCACTGAGTGGCGGCGGCTGCTGATTGTGTTCTAAGGGTCGGAGTGGGGTCGAC GTTTGCTCTACCGGAACAGCTTAGCTCATTCCTCCCTTTCCATTACCTGTGGCGCGGAGAGTTGGGGCGG CGGCTGCGTCAGCAAGGGCGGTGGTGGCGGCGGCGGCGGCGGCAGCTGCAGTGACATGTCCAGCATGAAT CCCGAATATGATTATTTATTCAAGTTACTTCTGATTGGCGATTCTGGGGTTGGAAAGTCCTGCCTTCTCC TTAGGTTTGCAGATGATACGTATACGGAAAGCTACATCAGCACAATTGGTGTGGATTTCAAGATACGAAC TATAGAGTTAGATGGGAAAACAATCAAGCTACAGATATGGGACACAGCAGGCCAGGAAAGATTTCGAACA ATCACTTCCAGTTATTACAGAGGAGCCCATGGCATCATAGTTGTGTATGATGTGACAGATCAGGAGTCCT TCAATAACGTTAAACAGTGGCTGCAGGAGATAGATCGCTACGCCAGTGAAAATGTCAACAAGTTGTTGGT AGGGAACAAATGTGACCTGACCACAAAGAAAGTAGTAGACTACACAACAGCAAAGGAATTTGCAGATTCC CTTGGAATTCCATTTTTGGAAACCAGTGCTAAGAACGCAACGAATGTAGAACAGTCTTTCATGACGATGG CAGCTGAGATTAAAAAGCGAATGGGTCCTGGAGCTACAGCTGGTGGTGCCGAGAAGTCCAATGTTAAAAT CCAGAGCACTCCAGTCAAGCAGTCAGGTGGAGGCTGCTGCTAAAATCTGCCTCCGTCCTTTTCTCACAGC AATGAATTCGCAATCTGAACCCAAGTGAAAAAACAAAATTGCCTGAATTGTACTGTATGTAGCTGCACTA CAACAGATTCTTACCGTTTCCACAAGGTCAGAGATTGTAAATGGTCAATACTGACTTTTTTTTTTATTCC CTTGACTCAAGACCGCTAACTTCATTTTCAGAACTGTTTTAAACCTTTGTGTGCTGGTTTATAAAATAAT GTGTGTAATCCTTGTTGCTTTCCTGATACCAGATCGTTTCCCGTGGTTGGTTAGAATATATTTTGTTTTG ATGTTTATATTGGCATGTTTAGATGTTGGGTTTAGTCTTCTGAAGATGAAGTTCAGCCATTTTGTATCAC ACAGCACAACCAGTGTCTGTCAGTTTCCACGCATAAAGTTTAGTGAGACGTTATATGTAAGATCTGATTT GCTAGTTCTTCCTGGTAGAGTTATAAATGGAAAGATTACACTATCTGATTAATAGTTTCTTCATACTCTG CATATAATTTGTGGCTGCAGAATATTGTAATTTGTTGCACACTATGTAACAAAACTGAAGATATGTTTAA TAAATATTGTACTTATTGGAAGTAATATCAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008996
Insert Size 618 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC002077, AAH02077
RefSeq Size 1444 bp
RefSeq ORF 618 bp
Locus ID 19324
UniProt ID P62821
Cytogenetics 11 12.92 cM
Gene Summary The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. RAB1A regulates vesicular protein transport from the endoplasmic reticulum (ER) to the Golgi compartment and on to the cell surface, and plays a role in IL-8 and growth hormone secretion. Regulates the level of CASR present at the cell membrane. Plays a role in cell adhesion and cell migration, via its role in protein trafficking. Plays a role in autophagosome assembly and cellular defense reactions against pathogenic bacteria (By similarity). Plays a role in microtubule-dependent protein transport by early endosomes and in anterograde melanosome transport.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.