Tgfa (BC003895) Mouse Untagged Clone

CAT#: MC200350

(untagged) - Mouse cDNA clone MGC:6757 IMAGE:3594209, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Tgfa
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC003895
  GGGCAGGAGGCTGGAGAGCCTGCTGCCCGCCCGCCCGTAAAATGGTCCCCTCGGCTGGACAGCTCGCCCT GTTCGCTCTGGGTATTGTGTTGGCTGCGTGCCAGGCCTTGGAGAACAGCACGTCCCCGCTGAGTGCAGAC CCGCCCGTGGCTGCAGCAGTGGTGTCCCATTTTAATGACTGCCCAGATTTTCACACTCAGTTCTGCTTCC ATGGAACCTGCAGGTTTTTGGTGCAGGAGGACAAGCCAGCATGTGTCTGCCATTCTGGGTACGTTGGTGC ACGCTGTGAGCATGCGGACCTCCTGGCCGTGGTGGCTGCCAGCCAGAAGAAGCAGGCCATCACCGCCTTG GTGGTGGTCTCCATCGTGGCCCTGGCTGTCCTTATCATCACATGTGTGCTGATACACTGCTGCCAGGTCC GAAAACACTGTGAGTGGTGCCGGGCCCTCATCTGCCGGCACGAGAAGCCCAGCGCCCTCCTGAAGGGAAG AACCGCTTGCTGCCACTCAGAAACAGTGGTCTGAAGAGCCCAGAGGAGGAGTTTGGCCAGGTGGACTGTG GCAGATCAATAAAGAAAGGCTTCTTCAGGACAGCACTGCCAGAGATGCCTGGGTGTGCCACAGACCTTCC TACTTGGCCTGTAATCACCTGTGCAGCCTTTTGTGGGCCTTCAAAACTCTGTCAAGAACTCCGTCTGCTT GGGGTTATTCAGTGTGACCTAGAGAAGAAATCAGCGGACCACGATTTCAAGACTTGTTAAAAAAGAACTG CAAAGAGACGGACTCCTGTTCACCTAGGTGAGGTGTGTGCAGCAGTTGGTGTCTGAGTCCACATGTGTGC AGTTGTCTTCTGCCAGCCATGGATTCCAGGCTATATATTTCTTTTTAATGGGCCACCTCCCCACAACAGA ATTGGAAGATCTGGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACT CCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: BC003895
• Insert Size: 483 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC003895
• RefSeq Size: 1042 bp
• RefSeq ORF: 483 bp
• Locus ID: 21802
• Cytogenetics: 6 37.62 cM
• Gene Summary: This gene encodes a member of the epidermal growth factor (EGF) family of proteins that regulate cellular proliferation. The encoded protein undergoes proteolytic processing to generate a soluble glycoprotein that is secreted by the cell. The secreted protein binds to the EGF receptors to initiate signaling events resulting in cellular proliferation, mucous production or inhibition of gastric acid secretion. The transgenic expression of the encoded protein in mice induces the development of cancers in various tissues such as liver, pancreas, skin and mammary glands. Mice lacking the encoded protein exhibit a wavy coat and curly whiskers phenotype as well as abnormalities in the eye. [provided by RefSeq, Sep 2015]