Gins4 (NM_024240) Mouse Untagged Clone

CAT#: MC200321

Gins4 (untagged) - Mouse GINS complex subunit 4 (Sld5 homolog) (Gins4), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gins4 (NM_024240) Mouse Untagged Clone
Symbol Gins4
Synonyms 2810037C03Rik; 4933405K01Rik; Sld5
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC002156 sequence for NM_024240
GGGAGCTGTACCGCTGCTGGTCGGGTCTGTGGGCCGCGGGCTTTCCGCGCGATCTCCGGCGCCCACCGCT CGGGGAGCCTCAGCCCGTGGTGTCCCCCGAGCGTGCCGGCTAGGAGAGAAGGGAAGAGGGATCCCTGAGC CGTGTAGCCGCTTTGAGTGCCAACTGCGAGGTGTAGGTTCCTGGTTGAGAAACGATGACGGAGGTTCTGG ATCTCCACGGACAGGACTCTGATGGGGGTAGTGAGGAGATGGTCCTAACTCCTGCAGAGCTCATTGAAAA GCTGGAGCAGGCCTGGATGAATGAAAAGTTTGCCCCTGAGCTCCTGGAAAGCAAGGCTGAGATTGTCGAA TGCGTCATGGAACAGCTTGAGCACATGGAAGAAAATCTCAGAAGAGCCAAGAAGGGGGATCTGAAGGTCA GCATCCATCGCATGGAGATGGAGAGGATCCGCTATGTCCTCAGCAGCTATTTGCGGTGTCGACTCATGAA GATAGAGAAGTTTTTCCCTCACATCCTAGAAAAGGAGAAAGTGCGCAGTGAGGGGGAGCCTTCCAGCCTG TCTCCAGAGGAGTTTGTCTTTGCCAAAGAGTATATGGACCACACGGAGACCCACTTTAAAAACGTTGCCT TAAAGCACATGCCTCCCAACCTGCAGAAGGTGGACCTCTTGAGGGCAGTTCCCAAACCAGACCTAGATTC ATACGTGTTTCTGCGAGTGAAAGAACGACAAGAAAACATACTAGTAGAACCAGAAGCCGATGAGCAGAGA GACTACGTGATTGACTTGGAGGTGGGCTCACAGCACTTGATCCGATACAAAACCATCGCACCTCTTGTTG CTTCTGGAGCAGTTCAGCTAATATAAAACAAAGCAAGCCTGAGGACATGGAGTGGTCACAGACAATATTA GAAACGCCATCTTTTGTGTCTAATAGTGAAGTCATGTTCCATACAGTTCGTCAGCAATGTGTGGACCACT TGGACGTAGAAAGGCGCCGATGCAGAATTCCCTTCGTTGTCACAGCCTTCTCCTAAATTCCTGTTTAACC AGCACCAACAGATGGGCCCGTGCTCTGAATACTCAGCAAATAAATCAACAGTCAGGAAAAAAAAAAAAAA AA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_024240
ORF Size 672 bp
Insert Size 672
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC002156, NP_077202
RefSeq Size 1122
RefSeq ORF 672
Locus ID 109145
Cytogenetics 8|8 A2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.