OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Efna1 (NM_010107) Mouse Untagged Clone

Be the first to review this product
SKU
MC200310
Efna1 (untagged) - Mouse ephrin A1 (Efna1), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free tGFP tGFP DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA311296 Goat Anti-EFNA1 Antibody
100 ug
$565.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Efna1 or NM_010107"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Efna1
Synonyms AI325262; B61; Efl1; Epl1; Eplg1; Lerk1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC002046 sequence for NM_010107
GGAGAAGCCTGTGGGAACCTTACACTGCAGAGCTCTCGTCCTGGCCTGGCTCGGCCCGGCCCCGCGCTAT GGAGTTCCTTTGGGCCCCTCTCTTGGGTCTGTGCTGCAGTCTGGCCGCTGCTGACCGCCACATCGTCTTC TGGAACAGTTCAAATCCCAAGTTCCGTGAGGAGGACTACACGGTGCACGTGCAGCTGAATGACTACCTAG ACATCATCTGCCCACATTACGAGGACGACTCTGTGGCAGATGCAGCCATGGAGCGATACACACTGTACAT GGTGGAACACCAGGAGTATGTGGCATGCCAACCCCAGTCCAAGGACCAGGTCCGTTGGAATTGCAACCGG CCCAGTGCCAAGCATGGCCCGGAGAAGCTGTCTGAGAAATTCCAGCGCTTCACGCCTTTTATCTTGGGCA AGGAGTTCAAGGAAGGACACAGCTACTACTACATCTCCAAACCTATCTACCATCAGGAATCCCAGTGCTT GAAGCTGAAGGTGACTGTCAATGGCAAAATCACTCATAATCCCCAGGCCCATGTCAACCCACAGGAGAAG AGACTCCAAGCAGATGACCCGGAAGTACAGGTTTTGCACAGCATTGGTTACAGTGCCGCCCCCCGCCTCT TCCCACTGGTCTGGGCAGTATTGCTCCTACCACTGCTGCTGCTGCAATCTCAGTGAGGGTGTACGCTTGC CCTGGCTTATGGATTGGAATGGGACTAAGGGGCAGCCCCAGCCCTGGGAACCTCTCCCACTACACCCACA AGACGCCACCATGAAGCCTCAAAAGGTTCAGTATTAAGGGTTTTAACCGAAAAGAGTTTAACCAGCCCAA CTGTGCCATCCCTGCCTCCACTTCAGAGGGATGGAGAAAGAAGTGGAGAAGGTCCTTAACCTGCAGTTTC TGCCTTTAAGCCAAAGAAACAAGCTGTGCGGACCTGGCCCATTAAGAGGCCTCAGTGGGAGAAGGGCTAA AAAGAGCCTGAGGTCATGCGGTTGGACACTGAACTTGGTAAAGACGTCCTTCCCCAAGGAAGCCATAATG TGCAGATGAACTGACCGAAGGAAAAGCTTGAGACAGCTTCCTGCGGGGGAGCCAGGTACAGAAGAGGCAG CTTGGGCTGACCCAGCATCTCTGCAAGATTTCCACCTGCTGGGCTGCCAGAGAGGTTTGTAGCCCGGCCC TGACTGCATCCTCCCCATCCCTGGGGCAACATTCCCTGGAGCTGTGCCAACAGGAGGACTGAAGCAGCCT GGTTTTAGAGTGTAGCTGTAAGGGCAGTGCCCGTGTGTACAGTCTGTGGAGTTTAGCTTAACGGGCAGGG CCCACATGTACAGTGTCTGTATATAAATGTGCTGTATCTGTTCATTTCTATGACTGCAGGGTTTTTTTAT ACAGTGTTTTTGGATTCATAATAAATTGATGGTTTTTTATGGAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI |
ACCN NM_010107
Insert Size 618 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC002046, AAH02046
RefSeq Size 1466 bp
RefSeq ORF 618 bp
Locus ID 13636
UniProt ID P52793
Cytogenetics 3 39.04 cM
Summary Cell surface GPI-bound ligand for Eph receptors, a family of receptor tyrosine kinases which are crucial for migration, repulsion and adhesion during neuronal, vascular and epithelial development. Binds promiscuously Eph receptors residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. Plays an important role in angiogenesis and tumor neovascularization. The recruitment of VAV2, VAV3 and PI3-kinase p85 subunit by phosphorylated EPHA2 is critical for EFNA1-induced RAC1 GTPase activation and vascular endothelial cell migration and assembly. Exerts anti-oncogenic effects in tumor cells through activation and down-regulation of EPHA2. Activates EPHA2 by inducing tyrosine phosphorylation which leads to its internalization and degradation. Acts as a negative regulator in the tumorigenesis of gliomas by down-regulating EPHA2 and FAK. Can evoke collapse of embryonic neuronal growth cone and regulates dendritic spine morphogenesis.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_010107" in other vectors (5)
SKU Description Size Price
MG202142 Efna1 (tGFP-tagged) - Mouse ephrin A1 (Efna1) 10 ug
$489.00 $500.00
MG226172 Efna1 (tGFP-tagged) - Mouse ephrin A1 (Efna1) transcript variant 1, (10ug) 10 ug
$530.00
MR226172 Efna1 (Myc-DDK-tagged) - Mouse ephrin A1 (Efna1), transcript variant 1 10 ug
$330.00
MR226172L3 Lenti ORF clone of Efna1 (Myc-DDK-tagged) - Mouse ephrin A1 (Efna1), transcript variant 1 10 ug
$630.00
MR226172L4 Lenti ORF clone of Efna1 (mGFP-tagged) - Mouse ephrin A1 (Efna1), transcript variant 1 10 ug
$630.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products