Sphk2 (BC006941) Mouse Untagged Clone

CAT#: MC200266

Sphk2 (untagged) - Mouse sphingosine kinase 2 (cDNA clone MGC:6851 IMAGE:2650442), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Sphk2 (BC006941) Mouse Untagged Clone
Symbol Sphk2
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC006941
TTTCAACACTTGGCCTGGCTCTGCCATTTAAAGTTGTGATCTTGGAGGCTGGTCCAGGAGCTGACCACAA GCCAAGAGCCTAGGAGTGCTTGGGACTGAACCAGGGTCATGGCCCCACCACCACTACTGCCAGTGGCTGC CAGCACTCCAATCCTGCACGGCGAGTTTGGTTCCTACCCGGCCAACGGCCCACGGTTTGCCCTCACCCTC ACAACACAAGCCCTACACATACAGCGACTACGCCCAAAGCCAGAAGCCCGGCCCCGAGATGGTCTAGTCT CTCTGGATGAGGTCTCGGGCTGTGGCACCCTGCAGAGCCGTAGCCCCGAGGACACTGCAGCCTACTTCTG CATCTACACCTACCCACGTGGCCGTCGAGGGGGCCGGCGCAGAGCTACGCGGACCTTCCGGGCGGATGGG GCCACCACTTATGAGGAGAATCGTGCAGAGGCCCAGCGCTGGGCCACTGCCCTCACGTGTCTCCTCCGAG GAGTGCCTCTGTCAGGGGACCAGGAAATCACCCCTGAATTGCTGCCCCGGAAGCCCAGGCTGCTCATATT GGTCAATCCCTTTGGGGGGCGGGGCCTGGCCTGGCAGCGCTGTATGGACCACGTGGTGCCAATGATCTCT GAAGCTGGGCTGTCCTTCAACCTCATACAGACAGAACGACAGAACCATGCCCGTGAGCTGGTGCAGGGGT TAAGCCTGAGTGAGTGGGAAGGCATTGTCACTGTGTCTGGAGACGGGCTGCTTTACGAGGTGCTGAATGG GCTCCTTGATCGGCCAGACTGGGAGGATGCCGTGCGGATGCCCATTGGTGTCCTCCCCTGTGGATCGGGC AATGCGCTAGCTGGGGCGGTGAACCATCATGGCGGGTTTGAGCAGGTTGTCGGTGTTGACCTGTTGCTCA ACTGCTCGCTTCTTCTCTGCCGTGGTGGCAGCCATCCTCTGGACCTGCTCTCTGTGACGCTAGCCTCGGG ATCCCGCTGTTTTTCCTTCCTGTCAGTGGCCTGGGGATTCTTGTCAGATGTGGACATTCACAGTGAGCGC TTCAGGGCCCTGGGCAGCGCTCGATTCACACTGGGTGCAGTGCTAGGCCTGGCCTCGTTGCATACCTACC GTGGACGCCTCTCCTACCTCCCCGCTACCACAGAACCAGCCTTGCCCATCCCAGGCCACAGTCTGCCTCG AGCCAAGTCAGAACTAGTCTTGGCTCCAGCCCCAGCCCCCGCCGCCACCCACTCGCCTCTACATCGATCT GTGTCTGACCTGCCCCTGCCCCTTCCCCAGCCTGCCTTGGTCTCCCCTGGCTCCCCTGAGCCCCTGCCTG ACCTGTCCCTCAATGGTGGTGGTCCAGAGCTGACTGGAGACTGGGGAGGAGCTGGGGATGCACCTCTGTC CCCAGACCCACTGCTGCCTTCATCCCCCAACGCTCTCAAAACAGCTCAGCTTTCACCCATCGCTGAAGGG CCCCCAGAAATGCCAGCATCTTCGGGGTTCCTGCCTCCCACCCACAGTGCCCCAGAAGCCTCTACCTGGG GCCCAGTGGACCACCTCCTCCCTCCCCTGGGCTCTCCACTGCCCCAAGACTGGGTGACAATAGAGGGGGA GTTTGTACTCATGTTGGGCATCTTGCCGAGCCACCTCTGCGCAGACCTGATGGCAGCCCCACATGCACGC TTTGATGATGGCGTTGTGCACCTGTGTTGGGTGCGGAGCGGCATCTCACGGGCTGCACTTCTACGCATTT TGCTGGCCATGGAGCATGGAAACCACTTCAGCCTGGGCTGCCCCCATCTGGGCTATGCTGCAGCACGTGC CTTCCGCCTTGAACCACTCACGCCTCGTGGCCTGCTCACTGTAGATGGGGAGTTAGTGGAGTATGGGCCA ATACAGGCGCAGGTGCACCCAGGTCTCGCCACGCTGCTCACTGGGCCTGCAGGTCAAAAGCCACAAGCCT GAACGAGCCTAAAAGCATGGCGAGTTGGTGGAACCAGCGCCCCATAGGCTAAGATCTATCATTTACAGGT AGAAGTGGGGCCCGCACTCAGAACTGTGAGGAGGGTGGAGAGTGGTCCTGACCCTCAGTTCCCAGAGGAC CTAGAGGCTCGAGGGTGGGGCCTGCCTTTCTTGATGTCCAATGATGGGGCCTGGAATGTATGAGCTAGCA AGGCTTCTTCAGCTTATTGACCAGCCAGGGTTTCTTCTTGCCTACTCCGGTGCCTCTACTTGACTGGCCA ATCAGCCCTTGAGGGGCAGGTTCCCCCAGGTGGTCCCCAGATTTGCACTAATGTTCCTCCCCTGGCCAGT TAGGGATGGGATGTTCTGTGTCTTGTGTGTCCCTCTCCCTAGTCTAAAAAGCAATTGAAAAGGTCTATGC AATAAAGGTTGTTGCTTCCCAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN BC006941
ORF Size 1854 bp
Insert Size 1854
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC006941,
RefSeq Size 2416
RefSeq ORF 1854
Locus ID 56632
Cytogenetics 7|7 B3
Gene Summary This gene encodes a kinase that phosphorylates sphingosine into sphingosine-1-phosphate, which is involved in cell differentiation, motility, and apoptosis. The encoded protein plays a role in maintaining cellular levels of sphingosine-1-phosphate. The gene product also enhances apoptosis in different cell types and suppresses cellular proliferation. In mast cells, the encoded protein is necessary for influx of calcium, protein kinase C activation, and cytokine production and degranulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010].
Transcript Variant:
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.