Ighg1 (BC008237) Mouse Untagged Clone
CAT#: MC200264
Ighg1 (untagged) - Mouse immunoglobulin heavy constant gamma 1 (G1m marker) (cDNA clone MGC:6522 IMAGE:2651217), (10ug)
Product Images
Frequently bought together (3)
Other products for "Ighg1"
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Ighg1 |
Synonyms | IgG1, VH7183 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC008237
ACACCTCACCATGAACTTTGGGCTCAGAATGATTTTCCTTGTCCTTACGTTAAAAGGTGTCCAGTGTGAA GTGCAACTGGTGGAGTCTGGGGGAGGCTTAGTGAAGCCAGGAGGGTCCCTGAAACTCTCCTGTGCAGCTT CTGGATTCAGTTTCAGTAACTATGACATGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGT CGCAGCCATTAATAGTGGTGGTAATATCTTCTGTCCAGACAGTGTGAAGGGTCGATTCACCATCTCCAGA GACAATGCCAAGAACACCCTGTACCTCCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATATATTACT GTGCAAGACGGGTATGGTTACGACGGGAGTACTACTTTGACTACTGGGGCCAAGGCACCACTATCACAGT CTCCTCGGCCAAAACGACACCCCCATCTGTCTATCCACTGGCCCCTGGATCTGCTGCCCAAACTAACTCC ATGGTGACCCTGGGATGCCTGGTCAAGGGCTATTTCCCTGAGCCAGTGACAGTGACCTGGAACTCTGGAT CCCTGTCCAGCGGTGTGCACACCTTCCCAGCTGTCCTGCAGTCTGACCTCTACACTCTGAGCAGCTCAGT GACTGTCCCCTCCAGCACCTGGCCCAGCCAGACCGTCACCTGCAACGTTGCCCACCCGGCCAGCAGCACC AAGGTGGACAAGAAAATTGTGCCCAGGGATTGTGGTTGTAAGCCTTGCATATGTACAGTCCCAGAAGTAT CATCTGTCTTCATCTTCCCCCCAAAGCCCAAGGATGTGCTCACCATTACTCTGACTCCTAAGGTCACGTG TGTTGTGGTAGACATCAGCAAGGATGATCCCGAGGTCCAGTTCAGCTGGTTTGTAGATGATGTGGAGGTG CACACAGCTCAGACAAAACCCCGGGAGGAGCAGTTCAACAGCACTTTCCGTTCAGTCAGTGAACTTCCCA TCATGCACCAGGACTGGCTCAATGGCAAGGAGTTCAAATGCAGGGTCAACAGTGCAGCTTTCCCTGCCCC CATCGAGAAAACCATCTCCAAAACCAAAGGCAGACCGAAGGCTCCACAGGTGTACACCATTCCACCTCCC AAGGAGCAGATGGCCAAGGATAAAGTCAGTCTGACCTGCATGATAACAGACTTCTTCCCTGAAGACATTA CTGTGGAGTGGCAGTGGAATGGGCAGCCAGCGGAGAACTACAAGAACACTCAGCCCATCATGGACACAGA TGGCTCTTACTTCGTCTACAGCAAGCTCAATGTGCAGAAGAGCAACTGGGAGGCAGGAAATACTTTCACC TGCTCTGTGTTACATGAGGGCCTGCACAACCACCATACTGAGAAGAGCCTCTCCCACTCTCCTGGTAAAT GATCCCAGTGTCCTTGGAGCCCTCTGGTCCTACAGGACTCTGACACCTACCTCCACCCCTCCCTGTGTAA ATAAAGCACCCAGCACTGCCTTGGGACCCTGCAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | BC008237 |
Insert Size | 1392 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC008237 |
RefSeq Size | 1523 bp |
RefSeq ORF | 1392 bp |
Locus ID | 111507 |
Cytogenetics | 12 F1-F2|12 |
Gene Summary | Summary:Immunoglobulins recognize foreign antigens and initiate immune responses such as phagocytosis and the complement system. Each immunoglobulin molecule consists of two identical heavy chains and two identical light chains. This region represents the germline organization of the heavy chain locus. The locus includes V (variable), D (diversity), J (joining), and C (constant) segments. During B cell development, a recombination event at the DNA level joins a single D segment with a J segment; this partially rearranged D-J gene is then joined to a V segment. The rearranged V-D-J is then transcribed with the IGHM constant region; this transcript encodes a mu heavy chain. Later in development B cells generate V-D-J-Cmu-Cdelta pre-messenger RNA, which is alternatively spliced to encode either a mu or a delta heavy chain. Mature B cells in the lymph nodes undergo switch recombination, so that the V-D-J gene is brought in proximity to one of the IGHG, IGHA, or IGHE genes and each cell expresses either the gamma, alpha, or epsilon heavy chain. Recombination of many different V segments with several J segments provides a wide range of antigen recognition. Additional diversity is attained by junctional diversity, resulting from the random additional of nucleotides by terminal deoxynucleotidyltransferase, and by somatic hypermutation, which occurs during B cell maturation in the spleen and lymph nodes. The RefSeq represents the IGH locus from C57BL/6. Several V and D segments in C57BL/6 are known to be incapable of encoding a protein and are considered pseudogenes. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.