Nudt5 (BC004571) Mouse Untagged Clone

CAT#: MC200239

Nudt5 (untagged) - Mouse nudix (nucleoside diphosphate linked moiety X)-type motif 5 (cDNA clone MGC:8023 IMAGE:3586340), (10ug)


Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nudt5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nudt5
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC004571
GCGGTGGCGCCTGATTCTACGGAGACTGCAGCTTCTGCCTGATCCTTTTTCCTTTCCTCCTCAATCCCTT CCACATCCCACAGTTTAGTGTAGCTTGAACTTTCCACCTGAGGACTGTGGAGGCCGACAAGTCGAAATGG AGACCCGAGAATCCACAGAGTCTTCTCCAGGCAAGCACCTTGTTACCTCAGAGGAGTTGATCTCAGAAGG AAAATGGGTCAAATTTGAAAAAACAACTTATATGGATCCCACTGGTAAAACCAGAACTTGGGAAACAGTG AAACTTACAACCAGGAAGGGAAAATCTGCTGATGCCGTGTCGGTCATACCTGTGCTGCAAAGAACCCTGC ACCATGAGTGCGTCATCCTGGTGAAGCAGTTCCGGCCCCCGATGGGCAGCTACTGCCTGGAGTTTCCAGC AGGGTTCATCGAAGACGGAGAAAACCCAGAGGCGGCTGCTCTTCGGGAGCTGGAGGAAGAAACTGGCTAC AAAGGTGAAGTTGCGGAATGCTCTCCAGCTGTGTGCATGGATCCAGGCTTGTCAAACTGCACCACACATG TTGTGACAGTGACCATCAATGGAGATGATGCAGGAAATGTAAGGCCAAAACCCAAACCAGGGGATGGAGA ATTTATGGAAGTGATTTCTTTACCAAAGAATGATCTGCTGACAAGACTTGACGCTTTGGGAGCAGAACAA CACCTTACAGTGGATGCCAAGGTCTACGCCTACGGTCTGGCTCTGAAACACGCCAACTCGAAGCCATTCG AAGTGCCCTTCCTCAAATTTTAAGGCCAAGGAGGACACTGGCCATGATTTGTAAATGAAACCATGCGGCC TTCACTATTCAGTGTATTCAATTAAGTTCAATGTAGGTCATAAATCAGCTTTTTTCGTAAAAGCAGCACA GATGCATGTGGTATGGAATTATAATTACAGAGAGGATATAACCTTCATTTAAATTTGTTAAATACTCATG GAAATGAGTGTATAGTTAGGTATGTTTAAATTTATTAAACTCACCTGGTCTAGAAGGTGAGGGTACTTCT CAGGAATAGACTCAAGCTCCCAATTAGGTCAGCTATTTCTACCCATAATTCCTAAAATCATGTACTGAAG TCTGCAAATAGCTATTTATTAGGCTCACATTTAAAAATTAGGTTGGGTTTTTGTTGTCTTGTTTTAAGAC AGGGTATCGCCATGTAGCCCTGGCTAGCCTGGAACTTCTTTTGCAGACCAGGCTGGCTTTGAACTCCGAG CGATTCATCTGTCTGTCTCTGCCTCTCCAAAGTTCTGGGAATAAAGATGTGTAGCACCACACATGGCAAG CAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN BC004571
Insert Size 657 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC004571, AAH04571
RefSeq Size 1348 bp
RefSeq ORF 657 bp
Locus ID 53893
Cytogenetics 2 A1
Gene Summary Enzyme that can either act as an ADP-sugar pyrophosphatase in absence of diphosphate or catalyze the synthesis of ATP in presence of diphosphate (By similarity). In absence of diphosphate, hydrolyzes with similar activities various modified nucleoside diphosphates such as ADP-ribose, ADP-mannose, ADP-glucose, 8-oxo-GDP and 8-oxo-dGDP (PubMed:10722730). Can also hydrolyze other nucleotide sugars with low activity (PubMed:10722730). In presence of diphosphate, mediates the synthesis of ATP in the nucleus by catalyzing the conversion of ADP-ribose to ATP and ribose 5-phosphate (By similarity). Nuclear ATP synthesis takes place when dephosphorylated at Thr-44 (By similarity). Nuclear ATP generation is required for extensive chromatin remodeling events that are energy-consuming (By similarity). Does not play a role in U8 snoRNA decapping activity (PubMed:21070968). Binds U8 snoRNA (PubMed:21070968).[UniProtKB/Swiss-Prot Function]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.