Ebp (NM_007898) Mouse Untagged Clone

CAT#: MC200135

Ebp (untagged) - Mouse phenylalkylamine Ca2+ antagonist (emopamil) binding protein (Ebp), (10ug)


  "NM_007898" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Ebp
Synonyms AI255399; m; mSI; P; Pabp; SI; Td
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC004620 sequence for NM_007898
GGCTATTAGGGAGCCTGCAGGTCTTCCTGGAAAGTCGCAAGCCTGTGTTAGGAAGTCGCCCTGCGATCGC GCCGCCTGGGGTTTTTCTGTCCCTTTGTCCTCGTTTATGTACGAAGCTGCCAGCGGGCCATAGAAACATG ACCACCAATACGGTCCCCTTGCACCCGTACTGGCCCAGGCACCTGAAGCTGGACAACTTCGTGCCTAATG ACCTCCCGACTTCGCATATCCTGGTTGGCCTCTTCTCCATCTCTGGGGGCCTAATTGTGATCACGTGGCT GTTGTCTAGCCGAGCTTCCGTCGTCCCACTTGGAGCTGGGCGGCGACTGGCCTTGTGCTGGTTTGCTGTG TGTACCTTCATTCACCTTGTGATCGAGGGCTGGTTCTCTCTCTACAATGGCATCCTTTTAGAAGACCAAG CCTTCTTATCCCAACTCTGGAAAGAGTATTCCAAGGGAGATAGCCGATATATCCTTAGTGACAGCTTCGT CGTCTGTATGGAGACTGTCACAGCTTGTCTCTGGGGACCACTCAGCCTATGGGTAGTGATTGCCTTTCTC CGCCAACAGCCCTTCCGCTTTGTCCTACAGCTTGTGGTGTCTATGGGCCAGATATACGGGGATGTGCTGT ACTTCCTGACAGAGCTACACGAAGGACTCCAGCATGGGGAGATAGGCCACCCCGTTTATTTCTGGTTCTA TTTTGTTTTCCTGAATGCTGTATGGTTGGTGATACCAAGCATCCTTGTGCTTGATGCCATAAAGCATCTC ACTAGTGCCCAGAGCGTGCTGGACAGCAAAGTCATGAAAATTAAGAGCAAGCATAACTAAAGAGCCGGAG AGTGGGCTGAGTCCCTGCTGATGAGGCGCTCTCCTCACTTCCCAGAAGACTCAAATCTTCTTCCTCCTCG CACAGGTTGGGGGGGTCAGAACTATCGGACTTGTCCCACTCAAACATGATGAGTGAGCACACAAAGGGCC AGAGTCAGAAAAGGAAGGGAACAAGTTGAGCTACTGCTAGGAACCTGAGGGAAAAGATGGATGAGAAGGT GGCAAGTCCGTGACGGTGGCAACTTCCCAAACCAGGAAATAAAATGTCTTTTACTAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007898
Insert Size 693 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC004620, AAH04620
RefSeq Size 1140 bp
RefSeq ORF 693 bp
Locus ID 13595
UniProt ID P70245
Cytogenetics X 3.7 cM
Gene Summary This gene encodes a transmembrane protein that localizes to the endoplasmic reticulum. This protein catalyses the conversion of delta8 to delta7 sterols, an important step in sterol biosynthesis. Mutations in this gene are responsible for the mouse tattered mutant phenotype. Tattered males are embryonic lethal, while heterozygous females have developmental defects. Deficiency of the related gene in human causes X-linked dominant chondrodysplasia punctata. [provided by RefSeq, May 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.