Igk (BC002112) Mouse Untagged Clone

CAT#: MC200073

(untagged) - Mouse cDNA clone MGC:6612 IMAGE:3488780, (10ug)


Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Igk
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002112
CAGCCTCACACTGATCACACACAGACATGAGTGTGCCCACTCAGGTCCTGGGGTTGCTGCTGCTGTGGCT TACAGATGCCAGATGTGACATCCAGATGACTCAGTCTCCAGCCTCCCTATCTGTCTCTGTGGGAGAAACT GTCACCATCACATGTCGAGCAAGTGAAAATATTTACAGTAATTTAGCATGGTATCAGCAGAAACAGGGAA AATCTCCTCAGCTCCTGGTCTATGCTGCAACAAACTTAGCAGATGGTGTGCCATCAAGATTCAGTGGCAG TGGATCAGGCACACAGTATTCCCTCACGATCAACAGCCTGCAGTCTGAAGATTTTGGGAGTTATTACTGT CAACATTTTTGGGGTACTCCGTTCACATTCGGAGGGGGGACCAAAGTGGGGATAAAACGGGCTGATGCTG CACCAACTGTATCCATCTTCCCACCATCCAGTGAGCAGTTAACATCTGGAGGTGCCTCAGTCGTGTGCTT CTTGAACAACTTCTACCCCAAAGACATCAATGTCAAGTGGAAGATTGATGGCAGTGAACGACAAAATGGC GTCCTGAACAGTTGGACTGATCAGGACAGCAAAGACAGCACCTACAGCATGAGCAGCACCCTCACGTTGA CCAAGGACGAGTATGAACGACATAACAGCTATACCTGTGAGGCCACTCACAAGACATCAACTTCACCCAT TGTCAAGAGCTTCAACAGGAATGAGTGTTAGAGACAAAGGTCCTGAGACGCCACCACCAGCTCCCCAGCT CCATCCTATCTTCCCTTCTAAGGTCTTGGAGGCTTCCCCACAAGCGACCTACCACTGTTGCGGTGCTCCA AACCTCCTCCCCACCTCCTTCTCCTCCTCCTCCCTTTCCTTGGCTTTTATCATGCTAATATTTGCAGAAA ATATTCAATAAAGTGAGTCTTTGCACTTGAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN BC002112
Insert Size 705 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC002112
RefSeq Size 954 bp
RefSeq ORF 705 bp
Locus ID 243469
Cytogenetics 6 30.89 cM
Gene Summary Summary:Immunoglobulins recognize foreign antigens and initiate immune responses such as phagocytosis and the complement system. Each immunoglobulin molecule consists of two identical heavy chains and two identical light chains. There are two classes of light chains, kappa and lambda. This region represents the germline organization of the kappa light chain locus from the C57BL/6J inbred mouse strain. The locus includes V (variable), J (joining), and C (constant) segments. During B cell development, a recombination event at the DNA level joins a single V segment with a J segment; the C segment is later joined by splicing at the RNA level. Recombination of many different V segments with several J segments provides a wide range of antigen recognition. Additional diversity is attained by junctional diversity, resulting from the random additional of nucleotides by terminal deoxynucleotidyltransferase, and by somatic hypermutation, which occurs during B cell maturation in the spleen and lymph nodes. Several V segments in this cluster are incapable of encoding a protein and are considered pseudogenes. [provided by RefSeq, Jul 2008]

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.