AKT2 (NM_001626) Human 3' UTR Clone

CAT#: SC220977

3`UTR clone of v-akt murine thymoma viral oncogene homolog 2 (AKT2) for miRNA target validation

Change vector?

USD 948.00


Availability*
1 Week

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name AKT2 (NM_001626) Human 3' UTR Clone
Vector pMirTarget
Symbol AKT2
Synonyms HIHGHH; PKBB; PKBBETA; PRKBB; RAC-BETA
ACCN NM_001626
Insert Size 3567
Sequence Data
Insert Sequence
>SC220977 3'UTR clone of NM_001626
The sequence shown below is from the reference sequence of NM_001626. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCAGTTCTCCTACTCGGCCAGCATCCGCGAGTGAGCAGTCTGCCCACGCAGAGGACGCACGCTCGCTGCC
ATCACCGCTGGGTGGTTTTTTCCCCCTAACTTTTTACTTAGCCTTTTTGGTTTGTGTCCCCACCCCCACC
TCCTCACCCCCTTTCCAGTTCTTCTTCAGGCCCCTCCCAGACGCACCCCAGCGGCCCCTGCAGCCCCTGC
CTCCAGCCTCCAGCCTCACCTTTGTGCCCAGACTCGCATTTGGAAGACTCCACCTCCCGCCCAGGCCTGG
GCTGTTGGGCGGTTGGAGATTCAGGTTTTAATCCACACAAGCCCCAGTGAGGGGTGAAGCATGGCGCCTG
GGGCCTGCCTGAGTTTCTGGCCTGGGTGTCGTGCTGGTGTCTGCCTCCGCGCTGCTGCATCTGGACGAAG
GCTGCCTTCTGGTGGGACGCGACACCCGGCAGACAGTGGTGCTGCCTTCCAGGCCCCGTGGCCTAGGCTC
GGAGTGGCCAGGCACGGGGCGGTCCAATCCCCCACCCGCTGTCCCCCTATGGGGGCAGAAAAGCAATAAT
GTCCAGGGGCAGGCAGGGGCCCTTGGGAGCTGCAGGGCTGGGGGTTAGGGCTGCTCCCTGGTGAATGGAG
TCAGATCCTAGGATCTGTACCATGGGGAACCAGGAGTGGCCGGGCTGGGTGCCGCCTCCTGGTCCGGCCT
CCTCCCCACCAAACTGTCCTCACCCTATGGATGAGGCAGGAGGAACATTTGGGGCCAAACCTGCCTGCCT
CCCAGCCCCGTGCCTTACTAGGGCTTCCTTCCAGCTGGCCTTACCTCCCGCTGGACCCTGGGCCTGGCCT
GGCCCCACTGGGGGCTATGGGCTGGGCTCACCCTCTCCTCTGCGGGGGTGGAGGGCCACCAGCCTTGGCT
GTTACAATCTTACACCGGACAGTATTGGGCCCCATGGACTTGGTCAGGGAGGGGTGGGGGTGGGCATCTC
TGGTACCTATTGGGGTGGGGGGCCTCTGAAAAGGGAGGCTCCTAGGCCCCCCTCACCCCTCCCTCTCCCC
AGGGCCCCACGTTCTGCAGCCTTAAGGTTGAACATGAGTGCACGTCCATGTCAGTGCTGTGGGACTCCTG
TGCGTGCCTCGGACTGCGTGTGTCGGCGGGACGCAGGCACACGTGGGTGTGTGTGCATGTGTGTTTGTGT
GAGGGCAGCGTGTCCTCCAGTGTGCATGGTGTGTGGGCTTGGGCCCCATCCCTGGCCCGAGCATTTCATC
CTGTGGGGGAGGGGTGCTGACCTAGTGGGAGGAGCCCCACTGTGATCCATGAGCTGCCCTGCCCACGCCT
CCCCTCCCTGTAGCAACACCTCTGGGTGTTTGGAGTTTAGCTTTTGTGGGTTTGCTCTCCCTATCCCATC
TCCTGTACTACACAGTTCATGGCAGGGTGGGGAGGGGTGGGGTTGGTTCGGGTGGGTGAGGGTCTTTTTC
CTCTGTGTGCGATGTTGTTATCTGACAGTTCTCCGTCCCTACTGGCCTTTCTCCTCGTCTTCATATTTGT
ACGGTACAAGCAATAAAGACACTCATTTCAGACCAGGGCCCAGCCTGCACTCACGCCAGCCCAACCACTC
TGGGCTTTGCCTTGGTGATGGAGTCAGACCCCTGGGCCCCAGCTCCTCCTGTACTAGCCGTTCCCTTCAG
CAAGGAGGGCACTGAGCTCAGGGTGAGGGCAGCTGGGGTGTGTGCAGGAGCTCAGGCTGGAGAGGGTGGG
TGGAGCTGGTGCTGTGGGGCTGAGGGGTATGGGAAGGCTCCCCGCATGTGGGGGTGGGGTGGACAGAGAC
CACTCCAGGCCCTCAGTGCTGCTTAGGCTAAGAGAGGTGGGGTGGAGGGACAGGGCTGGAAGATCTGGGT
AGCCCAGAATGAGGAGGGTGCCTGTGCTGTCACTGAATGAGAGGGAGTGGTTCATTCCACCCGGCTGCCG
AGCCTCAGAGGGGGGCATTCCTATCCTGCCCCACCTCCCTGTTTATGCTGCCACCTGGAAGCCTTGAGGC
CCCCAAATTCCAGTACAGACCCAGTGGTGTGTTCATGGTGGCGTGGTTGCTGTCACCTGGGAGCTCCTGA
GCGTTTGGTTAGAACCCTGTTCAGCTTGGGGTCAGCCCTCCCCTAGTCACTGCCCTTTAGCCTGGATGTG
TCTGGGCCCCTGCACTTCCCGTGCTTGAGTCACGTGGCTGCATGGCCGGGCGCTGGCCGGATGGAACACC
TCCCCCAGCAAGGGACCAGGGACCAGAGCCCTGGCCTGCCCTGCTGAGCCCTGCTGTGCAGAGGGCCTGG
CACAGATGAATTTGAGATTTTGCCGCAAGGTGTTAGCACTTCACACCCATTGAGTCTTTGAGATTTTAAG
TGAATGTAAGCAGAAAAAGTCAGATCCAATTTACAGAAATCAGAGTTAGCTACAGCTAGGACTCGTTTGG
TTGGGGTTTTTTAGTTTGTCTTTCTAAAGTCATGTGGACCTTAATTTAATTACAAAAGTCTACCCTGGTG
GTCATAAAATAGGCAGGCCTATGAAGAAAGGCCTTTTACTCTTCCATCTCATCCCAGCCCCGAGTTGACC
CACGTTGCTGCTCCTCACACCATGGTGATGCAGGTCTCGTAGTGTGGGCACAGGCCTGGCTACCTCATCT
TTTTAGTGCCTCTCTCCTCTTCCACAGGATGGGGTCCCACAGCTGCAGCAGCTGGCCCCGTAGTTGAGCA
TGTGTGGTTATCCTGTAGAGCTTTTCCCAAGAAGGGTGTTTGAACTTAGAGTCTTAATAAAATCTTACCA
AATAAATTTTGAGTAGAATAATCGTCTTTTGCAATGTACATTTTAAAAATTTCACACATTCTTTTTTGTA
TATAAAGAACAGTGACTGGGCACAGTGGCTCATGCCTGTAATCCCAGCAATTTGGGAGGCCGAGGCGGGC
GGGTCTCTTGAGGCCAGGGGTTCGAGACCAGCCTGGGCATCATAGGGAGACCTTCATCTCTACAAAAAAT
ACAAAAATTAGCTGGGCATGGTGGTGCATGCCTGCAATCCCAGCTAACTTGGAAGGCTGAGGTGAGGTGG
GAAGATCACTTGAGCCCAGGAGTTTGAGGCTGCAGTGAGCTATGATTGCGGCACTGCACTGCAGCCTGGG
ACAATGAGACTGTGTCTCTAAAAATAAAAAAAAAAAAAACATGATACATGCTATTAAAAAAGACAGCAAA
GCAGGAGTATAAGAAAGGAAATTCACCCGAGGTCGCAGGGCCTTGAGTACTCATTTTGGTGCTGATTACC
TCTCTGCAAATGGACACGGCATCATAAATTGGTAGTTTCCTGCTCTTTTTGTGTAATCTTTTCCAGTTAA
TGTGAAGCCTCTGGGGGCTGCCCTCGTGCACTGATGGTTGTGTGGAGTCGGGGGCGGCAGTGCGATTCCC
TTTTAGCTGCTGCATGGGGGGAACTCAGGCTTTCCAGCTGCTTCCTGGGGTTCCATGGGGTAGACCCCTC
AACCGCTTCAGCTGCCCCGTTAACAGGAATTGACTTGGTTTCGTTTGGTGCTACCAGCAGTCCTGTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001626.3
Synonyms HIHGHH; PKBB; PKBBETA; PRKBB; RAC-BETA
Summary This gene is a putative oncogene encoding a protein belonging to a subfamily of serine/threonine kinases containing SH2-like (Src homology 2-like) domains. The gene was shown to be amplified and overexpressed in 2 of 8 ovarian carcinoma cell lines and 2 of 15 primary ovarian tumors. Overexpression contributes to the malignant phenotype of a subset of human ductal pancreatic cancers. The encoded protein is a general protein kinase capable of phophorylating several known proteins. [provided by RefSeq, Jul 2008].
Locus ID 208
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents