TAL1 (NM_003189) Human 3' UTR Clone

CAT#: SC220834

3`UTR clone of T-cell acute lymphocytic leukemia 1 (TAL1) for miRNA target validation

Clone Modification / Custom Cloning Service

USD 845.00


Availability*
1 Week

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TAL1 (NM_003189) Human 3' UTR Clone
Vector pMirTarget
Symbol TAL1
Synonyms bHLHa17; SCL; tal-1; TCL5
ACCN NM_003189
Insert Size 3448
Sequence Data
>SC220834 3'UTR clone of NM_003189
The sequence shown below is from the reference sequence of NM_003189. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCCATCCTGCCATGCTGCCTGCCGCCGATGGAGCCGGCCCTCGGTGATGGGTCTGGGCCACCAGGATCAG
CCAGGAGGGCGTTCTTAGGCTGCTGGGATGGTGGGCTTCAGGGCAGGTGGGGTGAGAATTGGGCGGCTCT
GAAGCAAGGCGGTGGACTTGAACTTTCCTGGATGTCTGAACTTTGGGAAGCCTTTACTGACCCTGGGGCT
GGCTTTTCTGTTTCCTGTACCAGTAGGAGATCAGAAAAATGGAGCAAAGTGGTAGGTACTTTTTGTGAAG
ACGGCACGGTCTTCCCTCTTCCCTCAGTCCCAAATCCTTCCCAAGTAAGAGGCTGGAGTTGTCACTGCTT
TTGGCCTGGAGTTTGGGATCCCTGTCTTTCCTAAGACCTGGGGTTGTCAGCTCTCATCTGAGGCATCCAG
CAGTCTCTGCCTTGCCTTTAGCCCCTCCCAAGCTGGCTGGGGTGGCCTGTGTGGCCACTTCTGTCCATAT
TTATAGGTACCCAATAGCTGCCCATTTCGTGAGCCCCATCTTCACCCAGGCCTATGTTGATCCATCCAGC
TTGCCAGATGCTGCAGAGTCACAAGCCTCGAGGTGCCTTCTTCAGGGCCTGGTTGAAGAAGATGATCAGT
GGACAGTCTGCTCTAGATGAGCTGGGCCGGAGGGTCAGGAAACCCAGTCGCCCTTACTTCTTGCCCTGGG
GATCAAAGTTCTGCTTTCTCCCCAATGAGACTTGCCTTCCTAAGCCTGTGGCTGTGGAGACAATGTCTGC
AGCCCTGAGAAAGCCCTGTCGGGCTTTGTGTGAAGGCAGAGAAAGGGACAATGATAGTAGAGTGATATGG
AGCAAGAGATATTTTGGGCATGTGGGCTTCAACTCCTCGACATCACTGTTCATGCTGGCGAGTGAATGCC
AGTGTGCTGATGGGCGTACGCTGGTGCTGAGTAGATGCGCAGCCCCATCTGTGCATTCTCCTGGATGCTT
AGAGGGATTTCTTTGCTGTAAGATGTCTGTTTGCTGATGGTCTGGTCTATGTTCCGAATTGAGCACAAAA
CCTGTCCTATGAATGCTTTGCATTTGGAATTTTTGCTTGACTTCAGTTATTGGTGGAATCTTTAGCGCTC
AATAGGACCAGGATCCAGCCTCACTTCTAGGGTATGGGAAATCCAATCAGAGACCAGGCCCTGGCTAAGA
CCCAAACATATGCACATTCACTTAGCAGAACCTTAAACACCCCTCAGTTGTGCAGCTTTTGGTCATCAAG
GGTGCGTCTGGGAGGTTGGTTTAATGCAATAGAAGTGCTCCCCTCTGAAAGTTGTACATGAAATTTTTGT
AAATCACATCCTTATCCTTCATCTTTTAAAGAAATAACCACTGCAAGTCCTTTTGTAAAGTGAAGAATCC
TTTTGTAGAATGAACCACTGCCCCTTCATTGATTTCCTGTGTCAATCCAGATGGTGGGATGTGGTTTTCT
TAAGGTGAGGCCTGTCTGTGACCTGCATCTAAGCCCATGGGACAAATTGCACAGAAGTCCTGTATGTCTG
TCATTGTACCCTTAAGTCACCCTAGCCCTCTCCCTCTAGGCTCTGCCTTCGAGGTCAGAGGAGAGATAGC
CTGTGGCCCTGTCCTGCCATGCAAGAACTCATCACTGTGGCTGTCTGGAAAGCCCCCCCTTATAGTTTGG
GCTTCAGCCTAGTGGCTTGTCCTCACCATGATGGGGCCCTAATTCAGCCATGTACAGACAGAGAATATGT
CTGCTCCTTTCCCCTTCCTTTTAAGTAAGGTCCAATTCTCGAGCTTGGGGCAACATTGTTCACCTTTGTA
GCACTCAGGCTCTCCATTCAATTTCAGGCTCCCCAGATCATGTTTTGGTGAAAATTAGGGTTGGTTCCTT
TCCAACGTTTGGAAGATCCTGTGAGGAGCCCCATCTGTCTAAAGATAGAGTCATTGCTGTAGGATCTAAG
GCTGTTTGCTTCACCGTGGATTCGCTTGAGTTAGGAATGAGAAGTAGCCACAGTATGGATGGGTGGATGG
GTTTTATGAGATGGATCACATATTTTATTAAGAACTCAAACTTCTGGCTCCCTCTTCTTTCAGACTTGCC
ATGTGACTCTGGCTTGGCCTATCTCCTAGGGCTATGGTGTGGACTGAATGGGATCATGAAAGTAGACAGT
TTTGAGAACGTAAAGAACTTTTTCTTTTCCCTCAATCTCAATCCTGCAGTGGGGTTTCGCAGCCTGAGTC
CACGACCTAGGCAGTAGGCCGGTGTGCCTGACTGCCCAGCATTTGGGTAATTTAGATTGTAAACCGCTTT
GGCCTGAGTTATTGAGATTGTCCTCATTTCTCCAGATTATCTATTTGTGTGTGTGTGTGTGTGTGTGTGA
GAGACGGTGTCTTGTTCTGTCACTCAGGCTGGAGTACAGTGGTGCCATCATTGCTGTCTGCAGCCTTGAA
CTCTGGGCTCAAGCAATCCTCTCACCTCAGCCTCCCGAGTAGGGAGGACCACAGGTGTGAGCCACCACAC
CTGGCTAATTTTTACTTTTTTTTTTTTTTGGTAGAGATGGAGTCTTGCTATATTGCCCAGGCTGGTCTTG
AAGTCCTGGCTTCAGGCAATTCTCCTGCCTTTGCCTCCAGAAGCACTGGGATCACAGGTGTCAGCCATTG
CACCCAGCCCAGATTGTCTTAATTTCTATCTTGTTCCAAGGCCAGGGACAGTAATAAGAATGGAAAAGAG
ATATGGGAACACTGGCAGACTGTGTAAAATGTAATGCAACTACCCAAAACAAGCCTGGTAGGAAAGGGCA
AGTCTTTAGGTCTTTGTAAGAACTAAAGAAGATCTGTAATTTTTATTTTCACCCTCTGTACCCCATGACC
TTATCCTTCCTCTCCTTCCTTGTTACCCATGAAAAACTGGCAACATTCCAAGAATAGCATCTGTACAAAG
GGGAAAGAACATAAAGGTAAAACAAAACAAAACAACATTTTGAGAACAAAGATGACCATAACCACTGAAG
GGAATCACATCTTTTAAGACAAATTCATATTCTTTTATTTGTTATGGCAGATGACAAGATGGTACAACCT
TTATTCTTTTCCAAAATAAAACAAAGGGCACAGCATCTGTAGTCAGCCGACAACTATTTCGGCCTTTTGG
GGGTGGGTCTGGCCGTACTTGTGATTTCGATGGTACGTGACCCTCTGCTGAAGACTTGCCCCCTGCCCGT
GTACATAGTGCATTGTTTCTGTGGGCGGGCCCAGCACTTTCCGTCAACGTTGTACTGTATGTGATGAATT
GCGTTGGTCTCTGCATTTTTCTGCAGAAGAGGAGTAACCGCTCCAGGTACCTTGACCTTTGTACAGCCCA
GAGGCCAACACTGTGGGTGTGTGACTCTTTAGCAAAAAAAACCCATGTGGTGATGATGTGTATATATATG
TGAGGATGTATCGGGAAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_003189.2
Synonyms bHLHa17; SCL; tal-1; TCL5
Locus ID 6886
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents