E2F3 (NM_001949) Human 3' UTR Clone

CAT#: SC220669

3`UTR clone of E2F transcription factor 3 (E2F3) for miRNA target validation

Clone Modification / Custom Cloning Service

USD 845.00


Availability*
1 Week

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name E2F3 (NM_001949) Human 3' UTR Clone
Vector pMirTarget
Symbol E2F3
Synonyms E2F-3
ACCN NM_001949
Insert Size 3325
Sequence Data
>SC220669 3'UTR clone of NM_001949
The sequence shown below is from the reference sequence of NM_001949. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAAAGCTCCCACTGGTGGAAGACTTCATGTGTAGTTGATTATGCTTCGTGTGAACTCTCCTTAAAAACCG
ATATTTTTTTATCATGGAACCAGAACATCTGTCATGCAGTGTTGTCCCTTCCTACCTTCTTCCTCCAAGA
GAGTATCATGAAGTAAACTACAAACTTCAGAAGAAAGCTGACATTTTAATGAATTTTTTAAAAAATTAAT
AAACAAATTGTCTAAACGCACAGTTGCAGGCTCCCTTGGGAAAGCCCTGCTTTGCTCCAGGCTCCAAGAT
CTCCTGGCTAAGTCAGCAAGTGAGAAAATGTGCAATCAGGTGTCTCTCACCCCGAATTGTCCTTCCTCCT
TCCTCCCCGGATTGGCTTGCTGTGCCTGACGGATGGGCTGTAGAATGGGGTCTGGCCACCTGGCCTGCTG
GGAAACAGCAATCTTCCTTAATAGCATTTCAAGCCGTGCCTTCTCCGCAGAATGCATGTCTTTGAGGTCT
GCTAATATGGAATGGAACTGCAGCAAATGCAAACTTGAAGTCATGCAAAAGTATGAAATGGATTTCTTCA
GCTCTTCTTAGGAATATTTAAATTACTGTCATAATTCAGTTTAAGCTATGAACTGTGTGTCCCAGTAGGA
GGTCAAGAAAACCTCCACAGCCTTCTGGATGAAGAACCTGTTTTCAAATATACTTGTTGCAGATACAGAA
GACTAGTAGAGTTCTGCCACTCTAAGCTGTTGTGGATTTTCCTGTCTCCATGAACCACTCCCATTCCCCC
GTCCCCAATGTGTTTGTGAGTTTCCAGTTGATTTGTAGCAAATGCCTACTTAGTTCTTTGTGGATTGTTC
TAGACTTTTAATTTTTTTAGCTGCCATTTAAGCATTCCTGTGGCACCCATCACCATTTCAATTTAATTGT
TTACTTTGAAGCGGTTTTTGCAAATTCATATTACTTAAGCAGAGGGAGAGAACCTCTACTGATCAGAGCA
TCTAAACCTGTGTGATCTAAGGTTTATCAGCCTCTGCAAGGAGCTTTGTCCCATCGTGCTTCCATTCCCA
GGAGGGGGAGCTTGGAGCGAGTCAGTCCTGGGGCTTGCTGACATGGGTGGCCCATTGGAAAGGAGAACCA
GGTCAGATGATGTAACAGCCCCAAGGAGCAGCAGGCATGGGTCCCTCCATCCTTGGGCTTCCCGGGCCCC
TGTGACAGGGGAAAGGGCTCTCTTACACCGCACTCAGGGAGACCACTTCTCAGGATGGGGTCAGATGGAG
AGACCTCTAGGGAGAAAGACATCCCCATTGTGTGAGTGGCATTTCCTTAAGCTGGCAGGAACAGGGAGCA
GCCCTGTGTCGGGGGCTGGAATAGTTCTGGCCAGACCCCGTTCCCCTTCCTCTATGAAGGAATAAGTTGG
ACCAAGGGAAGTCGGGGACGTAAAAAATGAAGCAAAACAATGCCAGGGTGTCTCCCGCTTTACTCTTCAG
GAATGGTGTCCCAAGTTGGAGGCTTTGTGTCAGCTGCAAATCCTACCAGTTATGTCCAAGAATGGCTTTC
CCTCGGGCAGGTGGCAGCGGCCATCTCCCACTGGGAATATGGCGTAGTATCTCCGGTCCATTCCTTGGAT
GCTAAGGACTGCGGGAATGAGGGAGTCAGATAAAGAACAAACCTCGAAACGAACAGTTAAATTGAAATGC
TATGTGCCTGACCCAATGGTAGGCACATAGTAGGCACTCAACTCATATGTTTAATTGAATTGAAAATATC
CCTTAGGAAAAAAAAAAAACACACAAAAAACCACAAGAGCCCCAGCCAGTTTACTCCAGGTAGATTTCCA
CAATATGCAAAGTGGTGGTGGGGTCAAGACAGATGACACCAGCACTTTAAACTCTTTGTGTGGGTATGCG
TGGGTGTATGTTTGGGAAGAAAAACAAAGGTGCAGACTATCTTCCTTTTTTTCTTCTTCAGCCTCCATCC
CTGGCCTCCTCCCCTCACACACACTGGACTTGGTACAAAATGTCGGTGTGGTCCTAGATGAAGCATTGGG
GTGGGGGAGGGAGAGGGAGCTTTGTGTTAAGTGCCTACTGGAAATGCACTGTGGGGTTTTTTCCTGTATG
GGAAACCATTTATGCCAAGCTTTTCCCCATTTCCCATATTTATCTCATCTGGTTAGCTGCCTCTGCTTCC
AGCTTTGTGTAATTCTCTTTGCCAGCTGCACAAAGCTGATTTTTTCCAAAGTCTAAAGACTGAGCTCACC
TGGCTAGATTGTTGTGTGTTTTGTTGAATTTTTTCATAATGTAATGCCGTATTTATTGTTTTTAAAATGA
AAGGAATACTAATAAGTCTTAAAAGTTCCTTCATGCATAAGATTTTTTTCCAGTTACTGGGTTTAACTGG
TGTACATTAATTAGATGTCCATACTGTATTTTGTTTGCATTAAGTAATTTTCTTTTTGACTTAGTATCCG
GCACACAAAGTGGGTTAGTACTACAGTATTTGCGTTACTTTAAGTACTAAGTATGCAGGTTTCCTGGTAC
CATTGAGTTGCTGCTATTAAAGCTCACACACGAAATGGCTAAAAGTTACAAGTGTGCAAATTATGACTGC
GTGAGCCTTAGAAAATAAAATGTATAAAGGGCAACACATGAGCTGTCAAACAGTGTTAGGAGTGTGTTTA
TATGTACAGAGTTGTGCATAGCAATCGTTTTATTTAAGTTGATATGTAGTCTACTCACATTTTCATTATT
TAGCAATTTTGTACAAAAATAGCAATTAATTTGTAAACACTGCCAGAATACTTTCTAGCTGCTTTGTAAT
TTTTTAAGAGTGTTATTTTGTTTTTGTTTTTCTGTTCTTTGTTGTGGCTCTTGTTTTCATTTTTGTTGTA
CGTGTAGATCTGTAAATAAAATTGCAGTATTTAAAGCTTAAGCTTTCAGGAAAAAGAAAATAAGAATTCA
GTGTGTGCATGACAACTCGTGTGTATGAGAAGGAGGGATATGAAGGAAGATGGCTTGCAGAGTAAGTCGG
GTGGCAATTGTCAGGGTGTGGGAATTTCTTTTCCTACGGGGTACGTGATTTTGTAAAAAGGAAGTATTTC
TCCCAAAATTGGGAGTAGGCAAACTACTAATCAGTTTAGCTTTGTGTTGTATGCTAGTTTAAAAAAGAAA
ATATGTAATATAATGTAAAAAAAAACAAAAAAAAGCTTTTATGATGGATTTTGTAAATAGATTTGTTACA
GGGTGACCTGTTCTCTAGCTGTGATCTTACCACTTCAAATGGGTGTAATTTGAATAAATTTTGTATGGTA
AAGGATCAATAAAATGATTTTTTTTAAGAGTTAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001949.3
Synonyms E2F-3
Summary This gene encodes a member of a small family of transcription factors that function through binding of DP interaction partner proteins. The encoded protein recognizes a specific sequence motif in DNA and interacts directly with the retinoblastoma protein (pRB) to regulate the expression of genes involved in the cell cycle. Altered copy number and activity of this gene have been observed in a number of human cancers. There are pseudogenes for this gene on chromosomes 2 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Locus ID 1871
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents