CD46 (NM_172356) Human 3' UTR Clone

CAT#: SC217048

3`UTR clone of CD46 molecule complement regulatory protein (CD46) transcript variant j for miRNA target validation

USD 650.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name CD46 (NM_172356) Human 3' UTR Clone
Vector pMirTarget
Symbol CD46
Synonyms AHUS2; MCP; MGC26544; MIC10; TLX; TRA2.10
ACCN NM_172356
Insert Size 1925
Sequence Data
>SC217048 3'UTR clone of NM_172356
The sequence shown below is from the reference sequence of NM_172356. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCAACCACTCCAGCAGAGCAGAGAGGCTGAATAGATTCCACAACCTGGTTTGCCAGTTCATCTTTTGACT
CTATTAAAATCTTCAATAGTTGTTATTCTGTAGTTTCACTCTCATGAGTGCAACTGTGGCTTAGCTAATA
TTGCAATGTGGCTTGAATGTAGGTAGCATCCTTTGATGCTTCTTTGAAACTTGTATGAATTTGGGTATGA
ACAGATTGCCTGCTTTCCCTTAAATAACACTTAGATTTATTGGACCAGTCAGCACAGCATGCCTGGTTGT
ATTAAAGCAGGGATATGCTGTATTTTATAAAATTGGCAAAATTAGAGAAATATAGTTCACAATGAAATTA
TATTTTCTTTGTAAAGAAAGTGGCTTGAAATCTTTTTTGTTCAAAGATTAATGCCAACTCTTAAGATTAT
TCTTTCACCAACTATAGAATGTATTTTATATATCGTTCATTGTAAAAAGCCCTTAAAAATATGTGTATAC
TACTTTGGCTCTTGTGCATAAAAACAAGAACACTGAAAATTGGGAATATGCACAAACTTGGCTTCTTTAA
CCAAGAATATTATTGGAAAATTCTCTAAAAGTTAATAGGGTAAATTCTCTATTTTTTGTAATGTGTTCGG
TGATTTCAGAAAGCTAGAAAGTGTATGTGTGGCATTTGTTTTCACTTTTTAAAACATCCCTAACTGATCG
AATATATCAGTAATTTCAGAATCAGATGCATCCTTTCATAAGAAGTGAGAGGACTCTGACAGCCATAACA
GGAGTGCCACTTCATGGTGCGAAGTGAACACTGTAGTCTTGTTGTTTTCCCAAAGAGAACTCCGTATGTT
CTCTTAGGTTGAGTAACCCACTCTGAATTCTGGTTACATGTGTTTTTCTCTCCCTCCTTAAATAAAGAGA
GGGGTTAAACATGCCCTCTAAAAGTAGGTGGTTTTGAAGAGAATAAATTCATCAGATAACCTCAAGTCAC
ATGAGAATCTTAGTCCATTTACATTGCCTTGGCTAGTAAAAGCCATCTATGTATATGTCTTACCTCATCT
CCTAAAAGGCAGAGTACAAAGTAAGCCATGTATCTCAGGAAGGTAACTTCATTTTGTCTATTTGCTGTTG
ATTGTACCAAGGGATGGAAGAAGTAAATATAGCTCAGGTAGCACTTTATACTCAGGCAGATCTCAGCCCT
CTACTGAGTCCCTTAGCCAAGCAGTTTCTTTCAAAGAAGCCAGCAGGCGAAAAGCAGGGACTGCCACTGC
ATTTCATATCACACTGTTAAAAGTTGTGTTTTGAAATTTTATGTTTAGTTGCACAAATTGGGCCAAAGAA
ACATTGCCTTGAGGAAGATATGATTGGAAAATCAAGAGTGTAGAAGAATAAATACTGTTTTACTGTCCAA
AGACATGTTTATAGTGCTCTGTAAATGTTCCTTTCCTTTGTAGTCTCTGGCAAGATGCTTTAGGAAGATA
AAAGTTTGAGGAGAACAAACAGGAATTCTGAATTAAGCACAGAGTTGAAGTTTATACCCGTTTCACATGC
TTTTCAAGAATGTCGCAATTACTAAGAAGCAGATAATGGTGTTTTTTAGAAACCTAATTGAAGTATATTC
AACCAAATACTTTAATGTATAAAATAAATATTATACAATATACTTGTATAGCAGTTTCTGCTTCACATTT
GATTTTTTCAAATTTAATATTTATATTAGAGATCTATATATGTATAAATATGTATTTTGTCAAATTTGTT
ACTTAAATATATAGAGACCAGTTTTCTCTGGAAGTTTGTTTAAATGACAGAAGCGTATATGAATTCAAGA
AAATTTAAGCTGCAAAAATGTATTTGCTATAAAATGAGAAGTCTCACTGATAGAGGTTCTTTATTGCTCA
TTTTTTAAAAAATGGACTCTTGAAATCTGTTAAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_172356.1
Synonyms AHUS2; MCP; MGC26544; MIC10; TLX; TRA2.10
Summary The protein encoded by this gene is a type I membrane protein and is a regulatory part of the complement system. The encoded protein has cofactor activity for inactivation of complement components C3b and C4b by serum factor I, which protects the host cell from damage by complement. In addition, the encoded protein can act as a receptor for the Edmonston strain of measles virus, human herpesvirus-6, and type IV pili of pathogenic Neisseria. Finally, the protein encoded by this gene may be involved in the fusion of the spermatozoa with the oocyte during fertilization. Mutations at this locus have been associated with susceptibility to hemolytic uremic syndrome. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2010].
Locus ID 4179

Documents

Other products for "CD46"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies