TMPRSS2 (NM_001135099) Human 3' UTR Clone

CAT#: SC215536

Reviews ()
Write a review

3' UTR clone of transmembrane protease serine 2 (TMPRSS2) transcript variant 1 for miRNA target validation



Reconstitution Protocol

USD 759.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TMPRSS2
Synonyms PRSS10
ACCN NM_001135099
Insert Size 1629 bp
Sequence Data
>SC215536 3’UTR clone of NM_001135099
The sequence shown below is from the reference sequence of NM_001135099. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTTATCGACAAATGAGGGCAGACGGCTAATCCACATGGTCTTCGTCCTTGACGTCGTTTTACAAGAAA
ACAATGGGGCTGGTTTTGCTTCCCCGTGCATGATTTACTCTTAGAGATGATTCAGAGGTCACTTCATTT
TTATTAAACAGTGAACTTGTCTGGCTTTGGCACTCTCTGCCATTCTGTGCAGGCTGCAGTGGCTCCCCT
GCCCAGCCTGCTCTCCCTAACCCCTTGTCCGCAAGGGGTGATGGCCGGCTGGTTGTGGGCACTGGCGGT
CAAGTGTGGAGGAGAGGGGTGGAGGCTGCCCCATTGAGATCTTCCTGCTGAGTCCTTTCCAGGGGCCAA
TTTTGGATGAGCATGGAGCTGTCACCTCTCAGCTGCTGGATGACTTGAGATGAAAAAGGAGAGACATGG
AAAGGGAGACAGCCAGGTGGCACCTGCAGCGGCTGCCCTCTGGGGCCACTTGGTAGTGTCCCCAGCCTA
CCTCTCCACAAGGGGATTTTGCTGATGGGTTCTTAGAGCCTTAGCAGCCCTGGATGGTGGCCAGAAATA
AAGGGACCAGCCCTTCATGGGTGGTGACGTGGTAGTCACTTGTAAGGGGAACAGAAACATTTTTGTTCT
TATGGGGTGAGAATATAGACAGTGCCCTTGGTGCGAGGGAAGCAATTGAAAAGGAACTTGCCCTGAGCA
CTCCTGGTGCAGGTCTCCACCTGCACATTGGGTGGGGCTCCTGGGAGGGAGACTCAGCCTTCCTCCTCA
TCCTCCCTGACCCTGCTCCTAGCACCCTGGAGAGTGCACATGCCCCTTGGTCCTGGCAGGGCGCCAAGT
CTGGCACCATGTTGGCCTCTTCAGGCCTGCTAGTCACTGGAAATTGAGGTCCATGGGGGAAATCAAGGA
TGCTCAGTTTAAGGTACACTGTTTCCATGTTATGTTTCTACACATTGCTACCTCAGTGCTCCTGGAAAC
TTAGCTTTTGATGTCTCCAAGTAGTCCACCTTCATTTAACTCTTTGAAACTGTATCATCTTTGCCAAGT
AAGAGTGGTGGCCTATTTCAGCTGCTTTGACAAAATGACTGGCTCCTGACTTAACGTTCTATAAATGAA
TGTGCTGAAGCAAAGTGCCCATGGTGGCGGCGAAGAAGAGAAAGATGTGTTTTGTTTTGGACTCTCTGT
GGTCCCTTCCAATGCTGTGGGTTTCCAACCAGGGGAAGGGTCCCTTTTGCATTGCCAAGTGCCATAACC
ATGAGCACTACTCTACCATGGTTCTGCCTCCTGGCCAAGCAGGCTGGTTTGCAAGAATGAAATGAATGA
TTCTACAGCTAGGACTTAACCTTGAAATGGAAAGTCATGCAATCCCATTTGCAGGATCTGTCTGTGCAC
ATGCCTCTGTAGAGAGCAGCATTCCCAGGGACCTTGGAAACAGTTGGCACTGTAAGGTGCTTGCTCCCC
AAGACACATCCTAAAAGGTGTTGTAATGGTGAAAACGTCTTCCTTCTTTATTGCCCCTTCTTATTTATG
TGAACAACTGTTTGTCTTTTTTTGTATCTTTTTTAAACTGTAAAGTTCAATTGTGAAAATGAATATCAT
GCAAATAAATTATGCAATTTTTTTTTCAAAGTAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001135099.1
Summary This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a type II transmembrane domain, a receptor class A domain, a scavenger receptor cysteine-rich domain and a protease domain. Serine proteases are known to be involved in many physiological and pathological processes. This gene was demonstrated to be up-regulated by androgenic hormones in prostate cancer cells and down-regulated in androgen-independent prostate cancer tissue. The protease domain of this protein is thought to be cleaved and secreted into cell media after autocleavage. This protein also facilitates entry of viruses into host cells by proteolytically cleaving and activating viral envelope glycoproteins. Viruses found to use this protein for cell entry include Influenza virus and the human coronaviruses HCoV-229E, MERS-CoV, SARS-CoV and SARS-CoV-2 (COVID-19 virus). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2020]
Locus ID 7113
MW 60.3

Documents

Other products for "TMPRSS2"
Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 175.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.