FOXO4(FOXO4) (NM_005938) Human 3' UTR Clone

CAT#: SC214742

3`UTR clone of forkhead box O4 (FOXO4) for miRNA target validation

Clone Modification / Custom Cloning Service

USD 526.00


Availability*
4 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FOXO4(FOXO4) (NM_005938) Human 3' UTR Clone
Vector pMirTarget
Symbol FOXO4
Synonyms AFX; AFX1; MLLT7
ACCN NM_005938
Insert Size 1480
Sequence Data
Insert Sequence
>SC214742 3'UTR clone of NM_005938
The sequence shown below is from the reference sequence of NM_005938. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGGACTTCAACTTTGAGCCAGATCCCTGAGTCATGCCTGGAAGCTTTGTCCCCTGCTTCAGATGTGGAG
CCAGGCGTGTTCATATCTACTCTTTACCCTTGAGCCCTCCCCAGGAATTTGGGACCCTGCTTTAGAGCTA
GGGTGGGGTCTGGTCACACACAGGTGTTGAAGAAATTATAAAGATAAAGCTGCCCCATCTGGGGACGATA
TGGGGAGGGAGATGGGAGGGGAAAGGGGAGAGGGTTTTTCTCACTGTGCCAATTAGGGGGTAAGGCCCCC
TCTCAGGAGCCATCATCGGCTTTCCCCATTCCTACCCACTTAGGCTTTGTAGCAAGATGAGCAATGCTGT
TGGAAATGTGAAGTCACCAGTGGCCTTACCCCTGCCTTTGGGAGCAGGATTTTTTTGTAGAGAGTCTTAT
CTGAGCTGAGCCAGGCTAGCTGGAGCCTGGGATTTCTATGCAGTGGCCCCTTAGGCCAGTGATGTGCGGT
GGGTGGGCTGTTTAGGGGATCTGGAAGGGCCAAGGTCTGAGCACTGGAGTGGCTCGCCAGGCCAAATCAC
CCTTAGAAGGCTGCAGATAACAGAAAGGCTTTTTATAAACTTTTAAAGAAATATAAACACAAATATAGAG
ATTTTTTAACCATGGCAGGGTGCTAGTGGTGGGCAGAATGCTTTTTTTTCTTTCTGAAGGCTTTGTGATA
GTGACATGATACAAACACTACAGACAATAAATATTAGGAGACACAGGGAAGTGGGGAGAGGTGGGGAGTA
ATAGTAAACACAGGGAAGAGCTCCCCTACGGACCAGGTATAGAGAAAGGTCTATGCAGAAATAGGTTAGA
GTTTCCCTAACAAAAAAGCTAACCCAGGTCCCCTCATTCCTTCAACTTGTGCCTGGGAGTGTGTGGTGTT
AGGGTGCAGCCACACTCTTCTATGACCCAGCATGGGTTAGTGCTATGGTGGGAGAGTACATTGAAGGCCT
GGAATTAGCTTGGGGCCAGGGAAGGGACTGGGAGGGGAGAGAAGAGAAGGAGGGAAGGATTTAGGATGGT
AAAGTTAGGTACAGAGACCTCCCTGTTCAAGGCCCCTGACAGCTGTCCCTGCCCTTCTTCCCCTTCCCTG
ACTGCAGGGGTTATGTGGAAGTGTGTGTGGCAGCAGGCAGCGGGGAGGGGAGGAACAGGGAAGGGGGAGC
TGGGGAGCTTGGCTGAGGGTCTGGGAAATGAGCAGGGATGGGGGGGGATGTGGATCAGGTTTACTAGCAC
CTGCCAGGGAGGCCATCTGGGGCTCCTTCTCCACCCCAGCCCCCAAAGCAGCCCTTCCCCCAGTGCCCTT
TGCATCGTCCCCTCCCCCACCCCTGCTGTGGGTTCCCATCATTTCCTGTGTCAGCGCCTGGCCTACCCAG
ATTGTATCATGTGCTAGATTGGAGTGGGGAAGTGTGTCAAATCAATAAATGAATAAATTCAATAAATGCC
TATAACCAGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005938.3
Synonyms AFX; AFX1; MLLT7
Summary This gene encodes a member of the O class of winged helix/forkhead transcription factor family. Proteins encoded by this class are regulated by factors involved in growth and differentiation indicating they play a role in these processes. A translocation involving this gene on chromosome X and the homolog of the Drosophila trithorax gene, encoding a DNA binding protein, located on chromosome 11 is associated with leukemia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010].
Locus ID 4303
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (2)

Documents