KChIP2 (KCNIP2) (NM_173192) Human 3' UTR Clone

CAT#: SC214373

Reviews ()
Write a review

3`UTR clone of Kv channel interacting protein 2 (KCNIP2) transcript variant 3 for miRNA target validation



Reward yourself with an Amazon® Card when get any 3 cDNA clones.

USD 560.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name KChIP2 (KCNIP2) (NM_173192) Human 3' UTR Clone
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Symbol KCNIP2
Synonyms KCHIP2
ACCN NM_173192
Insert Size 1391 bp
Sequence Data
>SC214373 3'UTR clone of NM_173192
The sequence shown below is from the reference sequence of NM_173192. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGAGGTCCATGCAGCTCTTTGACAATGTCATCTAGCCCCCAGGAGAGGGGGTCAGTGTTTCCTGGGGGG
ACCATGCTCTAACCCTAGTCCAGGCGGACCTCACCCTTCTCTTCCCAGGTCTATCCTCATCCTACGCCTC
CCTGGGGGCTGGAGGGATCCAAGAGCTTGGGGATTCAGTAGTCCAGATCTCTGGAGCTGAAGGGGCCAGA
GAGTGGGCAGAGTGCATCTCGGGGGGTGTTCCCAACTCCCACCAGCTCTCACCCCCTTCCTGCCTGACAC
CCAGTGTTGAGAGTGCCCCTCCTGTAGGAATTGAGCGGTTCCCCACCTCCTACCCCTACTCTAGAAACAC
ACTAGACAGATGTCTCCTGCTATGGTGCTTCCCCCATCCCTGACCTCATAAACATTTCCCCTAAGACTCC
CCTCTCAGAGAGAATGCTCCATTCTTGGCACTGGCTGGCTTCTCAGACCAGCCATTGAGAGCCCTGTGGG
AGGGGGACAAGAATGTATAGGGAGAAATCTTGGGCCTGAGTCAATGGATAGGTCCTAGGAGGTGGCTGGG
GTTGAGAATAGAAGGGCCTGGACAGATTATGATTGCTCAGGCATACCAGGTTATAGCTCCAAGTTCCACA
GGTCTGCTACCACAGGCCATCAAAATATAAGTTTCCAGGCTTTGCAGAAGACCTTGTCTCCTTAGAAATG
CCCCAGAAATTTTCCACACCCTCCTCGGTATCCATGGAGAGCCTGGGGCCAGATATCTGGCTCATCTCTG
GCATTGCTTCCTCTCCTTCCTTCCTGCATGTGTTGGTGGTGGTTGTGGTGGGGGAATGTGGATGGGGGAT
GTCCTGGCTGATGCCTGCCAAAATTTCATCCCACCCTCCTTGCTTATCGTCCCTGTTTTGAGGGCTATGA
CTTGAGTTTTTGTTTCCCATGTTCTCTATAGACTTGGGACCTTCCTGAACTTGGGGCCTATCACTCCCCA
CAGTGGATGCCTTAGAAGGGAGAGGGAAGGAGGGAGGCAGGCATAGCATCTGAACCCAGTGTGGGGGCAT
TCACTAGAATCTTCAATCAACCTGGGCTCTCCCCACCCCACCCCAGATAACCTCCTCAGTTCCCTAGGGT
CTCTTCTTGCTTGACTCAATCTACCCAGAGATGCCCCTTAGCACACCTAGAGGGCAGGGACCATAGGACC
CAGGTTCCAACCCCATTGTCAGCACCCCAGCCATGCGGCCACCCCTTAGCACACCTGCTCGTCCCATTTA
GCTTACCCTCCCAGTTGGCCAGAATCTGAGGGGAGAGCCCCCAGAGAGCCCCCTTCCCCATCAGAAGACT
GTTGACTGCTTTGCATTTTGGGCTCTTCTATATATTTTGTAAAGTAAGAAATATACCAGAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_173192.2
Summary This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belongs to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified from this gene. [provided by RefSeq, Jul 2008]
Locus ID 30819

Documents

Other products for "KCNIP2"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools