N Cadherin(CDH2) (NM_001792) Human 3' UTR Clone

CAT#: SC213128

3`UTR clone of cadherin 2 type 1 N-cadherin (neuronal) (CDH2) for miRNA target validation

Clone Modification / Custom Cloning Service

USD 526.00


Availability*
1 Week

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name N Cadherin(CDH2) (NM_001792) Human 3' UTR Clone
Vector pMirTarget
Symbol CDH2
Synonyms CD325; CDHN; CDw325; NCAD
ACCN NM_001792
Insert Size 1186
Sequence Data
>SC213128 3'UTR clone of NM_001792
The sequence shown below is from the reference sequence of NM_001792. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTATGGTGGAGGTGATGACTGAACTTCAGGGTGAACTTGGTTTTTGGACAAGTACAAACAATTTCAACTG
ATATTCCCAAAAAGCATTCAGAAGCTAGGCTTTAACTTTGTAGTCTACTAGCACAGTGCTTGCTGGAGGC
TTTGGCATAGGCTGCAAACCAATTTGGGCTCAGAGGGAATATCAGTGATCCATACTGTTTGGAAAAACAC
TGAGCTCAGTTACACTTGAATTTTACAGTACAGAAGCACTGGGATTTTATGTGCCTTTTTGTACCTTTTT
CAGATTGGAATTAGTTTTCTGTTTAAGGCTTTAATGGTACTGATTTCTGAAACGATAAGTAAAAGACAAA
ATATTTTGTGGTGGGAGCAGTAAGTTAAACCATGATATGCTTCAACACGCTTTTGTTACATTGCATTTGC
TTTTATTAAAATACAAAATTAAACAAACAAAAAAACTCATGGAGCGATTTTATTATCTTGGGGGATGAGA
CCATGAGATTGGAAAATGTACATTACTTCTAGTTTTAGACTTTAGTTTGTTTTTTTTTTTTTCACTAAAA
TCTTAAAACTTACTCAGCTGGTTGCAAATAAAGGGAGTTTTCATATCACCAATTTGTAGCAAAATTGAAT
TTTTTCATAAACTAGAATGTTAGACACATTTTGGTCTTAATCCATGTACACTTTTTTATTTCTGTATTTT
TCCACTTCACTGTAAAAATAGTATGTGTACATAATGTTTTATTGGCATAGTCTATGGAGAAGTGCAGAAA
CTTCAGAACATGTGTATGTATTATTTGGACTATGGATTCAGGTTTTTTGCATGTTTATATCTTTCGTTAT
GGATAAAGTATTTACAAAACAGTGACATTTGATTCAATTGTTGAGCTGTAGTTAGAATACTCAATTTTTA
ATTTTTTTAATTTTTTTATTTTTTATTTTCTTTTTGGTTTGGGGAGGGAGAAAAGTTCTTAGCACAAATG
TTTTACATAATTTGTACCAAAAAAAAAAAAAAAGGAAAGGAAAGAAAGGGGTGGCCTGACACTGGTGGCA
CTACTAAGTGTGTGTTTTTTTAAAAAAAAAATGGAAAAAAAAAAGCTTTTAAACTGGAGAGACTTCTGAC
AACAGCTTTGCCTCTGTATTGTGTACCAGAATATAAATGATACACCTCTGACCCCAGCGTTCTGAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001792.3
Synonyms CD325; CDHN; CDw325; NCAD
Summary This gene encodes a classical cadherin and member of the cadherin superfamily. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein is proteolytically processed to generate a calcium-dependent cell adhesion molecule and glycoprotein. This protein plays a role in the establishment of left-right asymmetry, development of the nervous system and the formation of cartilage and bone. [provided by RefSeq, Nov 2015]
Locus ID 1000
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents