Peroxiredoxin 6(PRDX6) (NM_004905) Human 3' UTR Clone

CAT#: SC211606

3`UTR clone of peroxiredoxin 6 (PRDX6) for miRNA target validation

Change vector?

USD 526.00


Availability*
5 Days

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Peroxiredoxin 6(PRDX6) (NM_004905) Human 3' UTR Clone
Vector pMirTarget
Symbol PRDX6
Synonyms 1-Cys; aiPLA2; AOP2; HEL-S-128m; NSGPx; p29; PRX
ACCN NM_004905
Insert Size 982
Sequence Data
Insert Sequence
>SC211606 3'UTR clone of NM_004905
The sequence shown below is from the reference sequence of NM_004905. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTGGCAAGAAATACCTCCGCTACACACCCCAGCCTTAAGTCTCTTGGAGAAGCTGGTGCTGTGAGCCAGA
GGATGTCAGCTGCCAATTGTGTTTTCCTGCAGCAATTCCATAAACACATCCTGGTGTCATCACAGCCAAG
GTTTTTAGGTTGCTATACCAATGGCTTATTAAATGAAAATGGCACTAAAAGTTTCTTGAGATTCTTTATA
CTCTCTGCCTTCAGCAATCAATTCCATTCATACATCAGCACTCTGCTGGTTCTGTTTGAAATATGTTCTG
TATTTAAAACTCAAATCTTGTTGGATCTCTGCAGGGCTTGTGACCAATGAAGTCATATTTGTTGATGGTT
GACAAAGCTTGCTTCACTCCATCAGAGAATGACTATCAATTTTTTTTTAACTGTCCTATCACGTCCTCTC
CTGTCACCCATTTTGAAGAGTGGCAGAACTTGAAGTTCAACTTCCTCTGTAAATATCCAAGTATAAAGCC
CAGGAACTTCTAGAATAACCCAGATGCGCTTTAATTTTTTTTAATATGTTTTGATCACAGAACTTCTAGA
ATAACCCAGATGCTCTTTCATATTCTTTTAATACATCTTGATCACAGCTGGGGGAAAAAAAGCTTTTTAA
TTCTATACCTTCCTAGTAGATAAGTGAAGAGCAGGGAAAGAGACCTTTAAATATTTTGCTATAAAAAAAT
TTGTGATAAGTTTCTATCAAAATGGGGAGATTGCAGAAAAGGCTTCCCTTGGCTCCCAAGGAGGTGTAGC
AGGTGTGAGCAATATTAGTGCCATGTGCCTTTCACACAGGGTTTGCATTTATCAGTCTGTTTTCCGATGA
TGTGTACATGAAAGAGTACACCATGTGAAGAGAAGAGAGAATGATTGAAAATGTTTTAGTATAGAACTCT
TCTTGCAGTGGGTTGCTATTTTCTAGATTTTACTTTTTAGGGAACAAAATAAAATCCTTTGTTAAAACTG
GG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004905.2
Synonyms 1-Cys; aiPLA2; AOP2; HEL-S-128m; NSGPx; p29; PRX
Summary The protein encoded by this gene is a member of the thiol-specific antioxidant protein family. This protein is a bifunctional enzyme with two distinct active sites. It is involved in redox regulation of the cell; it can reduce H(2)O(2) and short chain organic, fatty acid, and phospholipid hydroperoxides. It may play a role in the regulation of phospholipid turnover as well as in protection against oxidative injury. [provided by RefSeq, Jul 2008].
Locus ID 9588
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents