SYTL2 (NM_001162953) Human 3' UTR Clone

CAT#: SC211506

Reviews ()
Write a review

3`UTR clone of synaptotagmin-like 2 (SYTL2) transcript variant i for miRNA target validation

USD 540.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name SYTL2 (NM_001162953) Human 3' UTR Clone
Vector pMirTarget
E. coli Selection Kanamycin (25 ug/mL)
Cell Selection Neomycin
Symbol SYTL2
Synonyms CHR11SYT; EXO4; PPP1R151; SGA72M; SLP2; SLP2A
ACCN NM_001162953
Insert Size 991
Sequence Data
>SC211506 3'UTR clone of NM_001162953
The sequence shown below is from the reference sequence of NM_001162953. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AACACTGCCTCTCAGAATGCTTTTGATTGCCAAGATTTCCAAATGAGCCCAAATTCCACTGGCTCCTCCA
CTGAAAACTACTAAACCGGTGGAATCTGATCTTGAAAATCTGAGTAGGTGGACAAATATCCTCACTTTCT
ATCTATTGCACCTAAGGAATACTACACAGCATGTAAAAGTCAATCTGCATGTGCTTCTTTGATTACAAGG
CCCAAGGGATTTAAATATAACAAAATGTGTAATTTGTGACTCTAATATTAAATAAGATATTTGAACAAGC
TAGGAAAATTGAATTTCTGCTGCTGCTTCAAAGAAAAAGCTGCCCCAGAGCATTAAACATGGGGTATTGT
TAAGAAGCAAAATGTTCTTGTTTGCCATCATGTGTTTCACACCACAATTCTGTGCCACAGTTAAGAGGGT
CTGGTACCCTTGCAGGACCTTTGTAGGTTGTGGGAAAAAGTCGCAGAAAGATACTCAAAGTGGAGCAGGG
AATGGAGACAGACATCAGTGATGATAAAAAAAAAAATGGACCTTAAGAAACTATTTACTCTGTAATCTCT
AATAAAATATGGAATTCCATATTAGGGCAATGAGACTGAAACTACTGGTGTTTTTCTGCCTTGAGAAAAC
AAACAGTTAAAACAAGCCTCAAATGTATTTTAGTGCCACCCACTGGCCATAGGTACAATTCAGTTGTTGG
CTTGTTTTGACTTAATTCTAAAATAGGTCTCAAGCCTGTATTTTTATGAGTTTATTTTTTTAAAACCCTG
CATATATATGATTGTTTTTCTTATAACTTTACTATATGAAAGCAGCATAAGAGTAGTCACAAACATGTTT
TGCAACAAAGTTTTAATTAGAATGTAAGTTGCTCAGTTATACTGTTCTTCTTATGTATGTAAAATTTTCG
TATTTTGTAAAAACCCTTAGAATAAATTATCATTTGATTTAAATTGTATTAGAAAATTAGCGTGACTTCT
CATTTTAAATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001162953.1
Synonyms CHR11SYT; EXO4; PPP1R151; SGA72M; SLP2; SLP2A
Summary The protein encoded by this gene is a synaptotagmin-like protein (SLP) that belongs to a C2 domain-containing protein family. The SLP homology domain (SHD) of this protein has been shown to specifically bind the GTP-bound form of Ras-related protein Rab-27A (RAB27A). This protein plays a role in RAB27A-dependent vesicle trafficking and controls melanosome distribution in the cell periphery. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jun 2009]
Locus ID 54843

Documents

Other products for "SYTL2"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones