DISC1 (NM_001164547) Human 3' UTR Clone

CAT#: SC211240

3`UTR clone of disrupted in schizophrenia 1 (DISC1) transcript variant j for miRNA target validation

USD 540.00


Availability*
4 Weeks

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name DISC1 (NM_001164547) Human 3' UTR Clone
Vector pMirTarget
Symbol DISC1
Synonyms C1orf136; SCZD9
ACCN NM_001164547
Insert Size 909
Sequence Data
>SC211240 3'UTR clone of NM_001164547
The sequence shown below is from the reference sequence of NM_001164547. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAACAAGTGTGAAGGAAAATACTATGAAGTACATGGAAACACTTAAGAATAAACTGTGCAGCTGCAAGTG
TCCACTGCTTGGGAAAGTGTGGGAAGCTGACTTGGAAGCTTGTCGATTGCTTATCCAGAGCCTACAGCTC
CAGGAAGCCAGGGGAAGCCTGTCTGTAGAAGATGAGAGGCAGATGGATGACTTAGAGGGAGCTGCTCCTC
CTATTCCCCCCAGGCTCCACTCCGAGGATAAAAGGAAGACCCCTTTGAAGGTATTGGAAGAATGGAAGAC
TCACCTCATCCCCTCTCTGCACTGTGCTGGAGGTGAACAGAAAGAGGTCTGTCCTTTTCACATGGCCTCC
AGAGGGGACCCTTATTCTAAGGGGTGCTTTGGGACCATGCTCCAAATGGGAACAATAAATATTGGGAAGG
CTTCCCATTGAGCATATAAACTTTTAAAAGTTTCAATAACTCTTGAATATGATTACAAAATAAAGTAGAA
TTTTTGTAGAAGTTTGAAATATAGAAGAGCAAAAAAACCCAACTTTTGGCATATTTAGTTCCATTTTCAT
TCTAATTTAGTGGCTAGAATTAGAATATGCAGTCTAATATAGAATTACCATATATAGCATACATTATATA
TGTCATATATAATATAGTTATTATATTCACTATAGATTATATATGCCATACATGATATTTAACATATATA
CTATACATTATGTATTGTATGTCATATATGATGTTTATATATTTAGAATCTATATATTACAATATATTAT
TATTTATTTGAATGAAACATTCAAATATATGTATTTATCCCATTAATTGTTTTTACCAAAACCAGATCAT
AATGAATGTTTATAATGTTCTTCTTTCATAAACACAACTAAAGTTTGGCCTGAGATATATGTATTACAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001164547.1
Synonyms C1orf136; SCZD9
Summary This gene encodes a protein with multiple coiled coil motifs which is located in the nucleus, cytoplasm and mitochondria. The protein is involved in neurite outgrowth and cortical development through its interaction with other proteins. This gene is disrupted in a t(1;11)(q42.1;q14.3) translocation which segregates with schizophrenia and related psychiatric disorders in a large Scottish family. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008].
Locus ID 27185

Documents

Other products for "DISC1"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies