DNA Polymerase theta (POLQ) (NM_199420) Human 3' UTR Clone

SKU
SC210783
3' UTR clone of polymerase (DNA directed) theta (POLQ) for miRNA target validation
$683.00
4 Weeks*
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol DNA Polymerase theta
Synonyms PRO0327
ACCN NM_199420
Insert Size 903 bp
Sequence Data
Insert Sequence
>SC210783 3’UTR clone of NM_199420
The sequence shown below is from the reference sequence of NM_199420. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGGGAGAGCTAAAGGACTTTGATGTGTAACTGTGCTGTTGATGAAGTCCTCCCAGGGAAGCCTGTGCA
GATGCAGTCACCTGGAAAGAACAGAGATTACCCTTTCACCTACCTCAGCAAAACAAACTTTCAAGTCTT
GATAGACTTAGCCTAGTAATTTTATAGTGAGAGTTTCAAACTATATATCAGTGTCTATAGCATCAAAAA
CTTCTGGGGGCGTGGGGGAAGTAGAATACCAAGTATAATAGTTACATTCACTTTCAAAGAGCATCTATG
AATTTGCCTTTTGTAACTTACTGTGGCTTTAAACATATTCAGAACAGATGCTTGAAATATGCACTTAGC
ACTTTGGTTCCACATCTGTCTGGGTAAACCATGAAGAAAATGAAGCTGCTGCCTCAATCGACCCAGACA
GCAGCCATAGGCAGATAAAGATTTGGTTTCACCCTGGTGGTGGTAGGCATCGTGTGTGACTTTTTTTCC
TCTAATATCAATTTTACAGTACGGAAATAGTATTTTAAAATAGTATTGGCTAATAAATTATGAATTCTA
TAAAGTAGTAAGACTTGGTATGGTTGGAGTGTAGGAATGAATATTCATGAAATGTTTCTTATTGCTTTT
CCTTCCCTAATTCATACAATGAATGTATTTGGAATACTTACATATTATAAAATAAACTATACCTCTTCA
AGAGGTATCCTGTTCTGTAAGATCAGATGTTTTTATTGCAGGTCAATATAATACTGCCAGAGACAGAAA
ATACCCCCTTATCAGTCCCTTAGTGCCTCTTTCTGTTTGTGGCATGGTGAGAAAACCCATGCTGAAAAG
ATTGTACTTTGTGATCCCAATCAGAGGGATGGAGCTAATCTTTTTGCTGTTGAAATAAAATGAATTTAT
GAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_199420.4
Locus ID 10721
Summary DNA polymerase that promotes microhomology-mediated end-joining (MMEJ), an alternative non-homologous end-joining (NHEJ) machinery triggered in response to double-strand breaks in DNA (PubMed:25642963, PubMed:25643323). MMEJ is an error-prone repair pathway that produces deletions of sequences from the strand being repaired and promotes genomic rearrangements, such as telomere fusions, some of them leading to cellular transformation (PubMed:25642963, PubMed:25643323). POLQ acts as an inhibitor of homology-recombination repair (HR) pathway by limiting RAD51 accumulation at resected ends (PubMed:25642963). POLQ-mediated MMEJ may be required to promote the survival of cells with a compromised HR repair pathway, thereby preventing genomic havoc by resolving unrepaired lesions (By similarity). The polymerase acts by binding directly the 2 ends of resected double-strand breaks, allowing microhomologous sequences in the overhangs to form base pairs. It then extends each strand from the base-paired region using the opposing overhang as a template. Requires partially resected DNA containing 2 to 6 base pairs of microhomology to perform MMEJ (PubMed:25643323). The polymerase activity is highly promiscuous: unlike most polymerases, promotes extension of ssDNA and partial ssDNA (pssDNA) substrates (PubMed:18503084, PubMed:21050863, PubMed:22135286). Also exhibits low-fidelity DNA synthesis, translesion synthesis and lyase activity, and it is implicated in interstrand-cross-link repair, base excision repair and DNA end-joining (PubMed:14576298, PubMed:18503084, PubMed:19188258, PubMed:24648516). Involved in somatic hypermutation of immunoglobulin genes, a process that requires the activity of DNA polymerases to ultimately introduce mutations at both A/T and C/G base pairs (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:DNA Polymerase theta (POLQ) (NM_199420) Human 3' UTR Clone
Your Rating

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.