UBP43 (USP18) (NM_017414) Human 3' UTR Clone

CAT#: SC207709

3' UTR clone of ubiquitin specific peptidase 18 (USP18) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: USP18
• Synonyms: ISG43; PTORCH2; UBP43
• ACCN: NM_017414
• Insert Size: 610 bp
• Sequence Data:
  Insert Sequence

  >SC207709 3’UTR clone of NM_017414
  The sequence shown below is from the reference sequence of NM_017414. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CTTCTGGTTTACATGAAGATGGAGTGCTAATGGAAATGCCCAAAACCTTCAGAGATTGACACGCTGTCA
  TTTTCCATTTCCGTTCCTGGATCTACGGAGTCTTCTAAGAGATTTTGCAATGAGGAGAAGCATTGTTTT
  CAAACTATATAACTGAGCCTTATTTATAATTAGGGATATTATCAAAATATGTAACCATGAGGCCCCTCA
  GGTCCTGATCAGTCAGAATGGATGCTTTCACCAGCAGACCCGGCCATGTGGCTGCTCGGTCCTGGGTGC
  TCGCTGCTGTGCAAGACATTAGCCCTTTAGTTATGAGCCTGTGGGAACTTCAGGGGTTCCCAGTGGGGA
  GAGCAGTGGCAGTGGGAGGCATCTGGGGGCCAAAGGTCAGTGGCAGGGGGTATTTCAGTATTATACAAC
  TGCTGTGACCAGACTTGTATACTGGCTGAATATCAGTGCTGTTTGTAATTTTTCACTTTGAGAACCAAC
  ATTAATTCCATATGAATCAAGTGTTTTGTAACTGCTATTCATTTATTCAGCAAATATTTATTGATCATC
  TCTTCTCCATAAGATAGTGTGATAAACACAGTCATGAATAAAGTTATTTTCCACAAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_017414.4
• Summary: The protein encoded by this gene belongs to the ubiquitin-specific proteases (UBP) family of enzymes that cleave ubiquitin from ubiquitinated protein substrates. It is highly expressed in liver and thymus, and is localized to the nucleus. This protein efficiently cleaves only ISG15 (a ubiquitin-like protein) fusions, and deletion of this gene in mice results in a massive increase of ISG15 conjugates in tissues, indicating that this protein is a major ISG15-specific protease. Mice lacking this gene are also hypersensitive to interferon, suggesting a function of this protein in downregulating interferon responses, independent of its isopeptidase activity towards ISG15. [provided by RefSeq, Sep 2011]
• Locus ID: 11274
• MW: 22.8