UBP43(USP18) (NM_017414) Human 3' UTR Clone

CAT#: SC207709

3`UTR clone of ubiquitin specific peptidase 18 (USP18) for miRNA target validation

Need custom modification / cloning service?
Get a free quote

USD 526.00


Availability*
5 Days

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name UBP43(USP18) (NM_017414) Human 3' UTR Clone
Vector pMirTarget
Symbol USP18
Synonyms ISG43; UBP43
ACCN NM_017414
Insert Size 605
Sequence Data
>SC207709 3'UTR clone of NM_017414
The sequence shown below is from the reference sequence of NM_017414. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCAGGAAACTGCATATCTTCTGGTTTACATGAAGATGGAGTGCTAATGGAAATGCCCAAAACCTTCAGAG
ATTGACACGCTGTCATTTTCCATTTCCGTTCCTGGATCTACGGAGTCTTCTAAGAGATTTTGCAATGAGG
AGAAGCATTGTTTTCAAACTATATAACTGAGCCTTATTTATAATTAGGGATATTATCAAAATATGTAACC
ATGAGGCCCCTCAGGTCCTGATCAGTCAGAATGGATGCTTTCACCAGCAGACCCGGCCATGTGGCTGCTC
GGTCCTGGGTGCTCGCTGCTGTGCAAGACATTAGCCCTTTAGTTATGAGCCTGTGGGAACTTCAGGGGTT
CCCAGTGGGGAGAGCAGTGGCAGTGGGAGGCATCTGGGGGCCAAAGGTCAGTGGCAGGGGGTATTTCAGT
ATTATACAACTGCTGTGACCAGACTTGTATACTGGCTGAATATCAGTGCTGTTTGTAATTTTTCACTTTG
AGAACCAACATTAATTCCATATGAATCAAGTGTTTTGTAACTGCTATTCATTTATTCAGCAAATATTTAT
TGATCATCTCTTCTCCATAAGATAGTGTGATAAACACAGTCATGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_017414.3
Synonyms ISG43; UBP43
Summary The protein encoded by this gene belongs to the ubiquitin-specific proteases (UBP) family of enzymes that cleave ubiquitin from ubiquitinated protein substrates. It is highly expressed in liver and thymus, and is localized to the nucleus. This protein efficiently cleaves only ISG15 (a ubiquitin-like protein) fusions, and deletion of this gene in mice results in a massive increase of ISG15 conjugates in tissues, indicating that this protein is a major ISG15-specific protease. Mice lacking this gene are also hypersensitive to interferon, suggesting a function of this protein in downregulating interferon responses, independent of its isopeptidase activity towards ISG15. [provided by RefSeq, Sep 2011].
Locus ID 11274
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents