OriGene Logo

DEPDC5 (NM_001007188) Human 3' UTR Clone

Be the first to review this product
SKU
SC207653
3' UTR clone of DEP domain containing 5 (DEPDC5) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "DEPDC5 or NM_001007188"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol DEPDC5
Synonyms DEP.5; FFEVF; FFEVF1
ACCN NM_001007188
Insert Size 592 bp
Sequence Data
Insert Sequence
>SC207653 3’UTR clone of NM_001007188
The sequence shown below is from the reference sequence of NM_001007188. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACACCAGCACTCGAGAGCACCTAGGATAAAGTGCAGTGATGCAATCACAGCTCACCTCAGTGCGGCCT
TGAACTCCTGGACTCAATCGATCCTCCCACCTCTGCCTCCCAAGTAACTGGGACTATAGCATGCCACCA
CACCCAGCTGATTATCATATTTTTTTTTGTAGAGGTGGGGAAGTGCAGTGATGCAATCACAGCTCACCT
CAGTGCGGCCTTGAACTCCTGGACTCAATTGATCCTCCCACTTCTGCCTCCCAAGTAACTGGGACTATA
GCATGCCACCACACCCAGCTGATTATCATATTTTTTTTTGTAGAGGTGGGGTTTTACCATTCCCAGGCT
GGTCTTGAACTCCTGGACTCGAGGGATCCACCCATTGGCCTCCAAAAGTGCTGAGATTACAGGCATGAA
CCAATGTTACCGCACCCTGCCTCTATTATACTATTTTTTGTTTAGCCTTTCTTCATCCATCATTTAACT
GTATGCCTTTCCATATGTTAATGGAAAGCTTTTCTTAGGCCTAGGGTCAAAAGGGTTTATTTCCTTATG
ATTTCCATTTGTGCCATATATAAAACAACCTCTGTCTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001007188.4
Locus ID 9681
Summary This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. provided by RefSeq, Mar 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.