OriGene Logo

BAG3 (NM_004281) Human 3' UTR Clone

Be the first to review this product
SKU
SC207648
3' UTR clone of BCL2-associated athanogene 3 (BAG3) for miRNA target validation
  $683.00
In Stock*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "BAG3 or NM_004281"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol BAG3
Synonyms BAG-3; BIS; CAIR-1; MFM6
ACCN NM_004281
Insert Size 567 bp
Sequence Data
Insert Sequence
>SC207648 3’UTR clone of NM_004281
The sequence shown below is from the reference sequence of NM_004281. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACACCCCTGGTAACCCAGCAGCACCGTAGCCTCTGCCCTGTAAAAATCAGACTCGGAACCGATGTGTG
CTTTAGGGAATTTTAAGTTGCATGCATTTCAGAGACTTTAAGTCAGTTGGTTTTTATTAGCTGCTTGGT
ATGCAGTAACTTGGGTGGAGGCAAAACACTAATAAAAGGGCTAAAAAGGAAAATGATGCTTTTCTTCTA
TATTCTTACTCTGTACAAATAAAGAAGTTGCTTGTTGTTTGAGAAGTTTAACCCCGTTGCTTGTTGTTC
TGCAGCCCTGTCTACTTGGGCACCCCCACCACCTGTTAGCTGTGGTTGTGCACTGTCTTTTGTAGCTCT
GGACTGGAGGGGTAGATGGGGAGTCAATTACCCATCACATAAATATGAAACATTTATCAGAAATGTTGC
CATTTTAATGAGATGATTTTCTTCATCTCATAATTAAAATACCTGACTTTAGAGAGAGTAAAATGTGCC
AGGAGCCATAGGAATATCTGTATGTTGGATGACTTTAATGCTACATTTTAAAAAAAGAAAATAAAGTAA
TAATATAACTCAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004281.4
Locus ID 9531
Summary BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The protein encoded by this gene contains a WW domain in the N-terminal region and a BAG domain in the C-terminal region. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.