OriGene Logo

P2RX4 (NM_002560) Human 3' UTR Clone

Be the first to review this product
SKU
SC207622
3' UTR clone of purinergic receptor P2X ligand-gated ion channel 4 (P2RX4) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "P2RX4 or NM_002560"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol P2RX4
Synonyms P2X4; P2X4R
ACCN NM_002560
Insert Size 587 bp
Sequence Data
Insert Sequence
>SC207622 3’UTR clone of NM_002560
The sequence shown below is from the reference sequence of NM_002560. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGGTCTTGCTAGTGAGCTGGACCAGTGAGGCCTACCCCACACCTGGGCTCTCCACAGCCCCATCAAA
GAACAGAGAGGAGGAGGAGGGAGAAATGGCCACCACATCACCCCAGAGAAATTTCTGGAATCTGATTGA
GTCTCCACTCCACAAGCACTCAGGGTTCCCCAGCAGCTCCTGTGTGTTGTGTGCAGGATCTGTTTGCCC
ACTCGGCCCAGGAGGTCAGCAGTCTGTTCTTGGCTGGGTCAACTCTGCTTTTCCCGCAACCTGGGGTTG
TCGGGGGAGCGCTGGCCCGACGCAGTGGCACTGCTGTGGCTTTCAGGGCTGGAGCTGGCTTTGCTCAGA
AGCCTCCTGTCTCCAGCTCTCTCCAGGACAGGCCCAGTCCTCTGAGGCACGGCGGCTCTGTTCAAGCAC
TTTATGCGGCAGGGGAGGCCGCCTGGCTGCAGTCACTAGACTTGTAGCAGGCCTGGGCTGCAGGCTTCC
CCCCGACCATTCCCTGCAGCCATGCGGCAGAGCTGGCATTTCTCCTCAGAGAAGCGCTGTGCTAAGGTG
ATCGAGGACCAGACATTAAAGCGTGATTTTCTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002560.3
Locus ID 5025
Summary The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel with high calcium permeability. The main pharmacological distinction between the members of the purinoceptor family is the relative sensitivity to the antagonists suramin and PPADS. The product of this gene has the lowest sensitivity for these antagonists. Multiple alternatively spliced transcript variants, some protein-coding and some not protein-coding, have been found for this gene. provided by RefSeq, Feb 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.