OriGene Logo

HTRA2 (NM_145074) Human 3' UTR Clone

Be the first to review this product
SKU
SC207612
3' UTR clone of HtrA serine peptidase 2 (HTRA2) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "HTRA2 or NM_145074"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol HTRA2
Synonyms MGCA8; OMI; PARK13; PRSS25
ACCN NM_145074
Insert Size 601 bp
Sequence Data
Insert Sequence
>SC207612 3’UTR clone of NM_145074
The sequence shown below is from the reference sequence of NM_145074. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTATATGTGACCCCTGAGGTCACAGAATGAATAGATCACCAAGAGTATGAGGCTCCTGCTCTGATTTCC
TCCTTGCCTTTCTGGCTGAGGTTCTGAGGGCACCGAGACAGAGGGTTAAATGAACCAGTGGGGGCAGGT
CCCTCCAACCACCAGCACTGACTCCTGGGCTCTGAAGAATCACAGAAACACTTTTTATATAAAATAAAA
TTATACCTAGCAACATATTATAGTAAAAAATGAGGTGGGAGGGCTGGATCTTTTCCCCCACCAAAAGGC
TAGAGGTAAAGCTGTATCCCCCTAAACTTAGGGGAGATACTGGAGCTGACCATCCTGACCTCCTATTAA
AGAAAATGAGCTGCTGCCATCTTTTGTGGGCAGTTAGTCAGGTGCTGCTCTTTGTGGTGTGGTGGGCTC
TGGTCTGTTCTGCTCGGTGCTGGGCCTGGGAGCAAAGATTCCCATGCTTGGCTACAGATACTGACAGCT
GGCCTCTGAAGGAGGGTGAAAACTTCTGCTTGACAGTTCCACATCCATAGTGCATGGTCTGATGAGTGC
GGTTGCTGACATGGGTTTCTTGGTAAGCTCCTGAGGTAATGGCAGCCTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_145074.2
Locus ID 27429
Summary This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. provided by RefSeq, Mar 2016
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.